Miyakogusa Predicted Gene
- Lj0g3v0097909.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0097909.1 Non Chatacterized Hit- tr|I1LDL9|I1LDL9_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max PE=4,91.1,0,Pectin
lyase-like,Pectin lyase fold/virulence factor;
Glyco_hydro_28,Glycoside hydrolase, family 28;,CUFF.5473.1
(498 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67181 similar to UniRef100_Q2HUV5 Cluster: Glycoside ... 313 6e-85
gnl|LJGI|TC70052 similar to UniRef100_Q2HUV5 Cluster: Glycoside ... 254 5e-67
gnl|LJGI|GO012331 similar to UniRef100_A7QNJ7 Cluster: Chromosom... 64 9e-10
gnl|LJGI|TC63331 similar to UniRef100_A7QNJ7 Cluster: Chromosome... 64 9e-10
>gnl|LJGI|TC67181 similar to UniRef100_Q2HUV5 Cluster: Glycoside hydrolase, family
28; n=1; Medicago truncatula|Rep: Glycoside hydrolase,
family 28 - Medicago truncatula (Barrel medic), partial
(33%)
Length = 624
Score = 313 bits (158), Expect = 6e-85
Identities = 164/166 (98%)
Strand = Plus / Plus
Query: 58 agaggaagggatgcacctgctggaaggttcagtagtctcatttttggaacacacctcact 117
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 459 agaggaagggatgcacctgctggaaggttcagtagtctcatttttggaacaaacctcact 518
Query: 118 gatgttgttattactggtcacaatggtactattgatgggcaaggatcttactggtgggac 177
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 519 gatgttgttattactggtcacaatggtactattgatgggcaaggatcttactggtgggac 578
Query: 178 aagttccacaagggacaatttaaactcaccaggccttacatgattg 223
|||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 579 aagttccacaagggacaatttacactcaccaggccttacatgattg 624
>gnl|LJGI|TC70052 similar to UniRef100_Q2HUV5 Cluster: Glycoside hydrolase, family
28; n=1; Medicago truncatula|Rep: Glycoside hydrolase,
family 28 - Medicago truncatula (Barrel medic), partial
(43%)
Length = 934
Score = 254 bits (128), Expect = 5e-67
Identities = 134/136 (98%)
Strand = Plus / Plus
Query: 363 agatggaattgatcctgattcttgttcaaacactaggattgaagattgctatattgtatc 422
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 6 agatggaattgatcctgattcttgttccaacactaggattgaagattgctatattgtatc 65
Query: 423 tggtgatgattgcattgcagtgaaaagtggttgggatgagtatggaatcaaagttgggat 482
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 66 tggtgatgattgcattgcagtgaaaagtggttgggatgagtatggaatcaaagttgggat 125
Query: 483 gccaagccagcacata 498
||||||||| ||||||
Sbjct: 126 gccaagccaacacata 141
>gnl|LJGI|GO012331 similar to UniRef100_A7QNJ7 Cluster: Chromosome chr2 scaffold_132,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr2 scaffold_132, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (34%)
Length = 687
Score = 63.9 bits (32), Expect = 9e-10
Identities = 77/92 (83%)
Strand = Plus / Plus
Query: 376 cctgattcttgttcaaacactaggattgaagattgctatattgtatctggtgatgattgc 435
||||| ||||| ||||||| |||||||||| || |||||||| ||||| ||||| ||
Sbjct: 450 cctgactcttgcacaaacacacggattgaagactgttatattgtgtctggggatgactgt 509
Query: 436 attgcagtgaaaagtggttgggatgagtatgg 467
| || ||||| ||||||||||||||||||||
Sbjct: 510 gtggctgtgaagagtggttgggatgagtatgg 541
>gnl|LJGI|TC63331 similar to UniRef100_A7QNJ7 Cluster: Chromosome chr2 scaffold_132,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr2 scaffold_132, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (63%)
Length = 1080
Score = 63.9 bits (32), Expect = 9e-10
Identities = 77/92 (83%)
Strand = Plus / Plus
Query: 376 cctgattcttgttcaaacactaggattgaagattgctatattgtatctggtgatgattgc 435
||||| ||||| ||||||| |||||||||| || |||||||| ||||| ||||| ||
Sbjct: 231 cctgactcttgcacaaacacacggattgaagactgttatattgtgtctggggatgactgt 290
Query: 436 attgcagtgaaaagtggttgggatgagtatgg 467
| || ||||| ||||||||||||||||||||
Sbjct: 291 gtggctgtgaagagtggttgggatgagtatgg 322