Miyakogusa Predicted Gene

Lj0g3v0097749.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0097749.1 Non Chatacterized Hit- tr|G7LCB4|G7LCB4_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,37.66,0.00000006, ,CUFF.5567.1
         (697 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL...    96   4e-19
gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Ea...    80   2e-14
gnl|LJGI|FS340012                                                      54   1e-06

>gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL074Wp; n=1;
           Eremothecium gossypii|Rep: ACL074Wp - Ashbya gossypii
           (Yeast) (Eremothecium gossypii), partial (8%)
          Length = 691

 Score = 95.6 bits (48), Expect = 4e-19
 Identities = 117/140 (83%)
 Strand = Plus / Minus

                                                                       
Query: 119 ctgaagagaagaagttctcggaggctgagatggctttgacgggagatgctttcttctggt 178
           ||||||||||||| ||||| ||||| |||| ||  |||||| | ||||| ||||| ||||
Sbjct: 628 ctgaagagaagaaattctcagaggcagagaaggtgttgacgcgtgatgcgttcttttggt 569

                                                                       
Query: 179 ggtatttctggaaaagaagaaaccagaatgcaaaatggtgggattttgtgaaggctttac 238
           |||||| |||||||| | |||| ||||  ||||||||||||||||||||||  || || |
Sbjct: 568 ggtattcctggaaaaaacgaaatcagagggcaaaatggtgggattttgtgatagcattgc 509

                               
Query: 239 tgaagaaattccaaccagaa 258
           ||| | ||||| ||||||||
Sbjct: 508 tgagggaattcgaaccagaa 489


>gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Early growth response
           protein 1; n=2; Mus musculus|Rep: Early growth response
           protein 1 - Mus musculus (Mouse), partial (4%)
          Length = 479

 Score = 79.8 bits (40), Expect = 2e-14
 Identities = 142/176 (80%)
 Strand = Plus / Plus

                                                                       
Query: 88  gtggagcagcactgtgaggccatggaaatggctgaagagaagaagttctcggaggctgag 147
           |||||||| ||||||||||||| || | |  | |||||| |||| ||||| | ||| |||
Sbjct: 123 gtggagcaacactgtgaggccaagggagtatccgaagaggagaaattctcaggggcagag 182

                                                                       
Query: 148 atggctttgacgggagatgctttcttctggtggtatttctggaaaagaagaaaccagaat 207
           | ||||||||| || || |||||| | ||||||| || ||||| |||| | || ||||| 
Sbjct: 183 aaggctttgactggtgaagctttcatgtggtggttttgctggagaagacgcaatcagaag 242

                                                                   
Query: 208 gcaaaatggtgggattttgtgaaggctttactgaagaaattccaaccagaaatgga 263
           |||| ||||||||| |||||| ||||| |  ||| ||||||| |||||||| ||||
Sbjct: 243 gcaacatggtgggaatttgtggaggctctgttgaggaaattcgaaccagaattgga 298


>gnl|LJGI|FS340012 
          Length = 685

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 111/139 (79%)
 Strand = Plus / Plus

                                                                       
Query: 91  gagcagcactgtgaggccatggaaatggctgaagagaagaagttctcggaggctgagatg 150
           |||||| |||||||||||| || |||  | || |||||||| ||||| | ||| |||| |
Sbjct: 334 gagcagtactgtgaggccaagggaatatcagaggagaagaaattctcagtggcggagaag 393

                                                                       
Query: 151 gctttgacgggagatgctttcttctggtggtatttctggaaaagaagaaaccagaatgca 210
           || |||||| | |||||| || | |||||| |   ||||||||||||||| ||||  |||
Sbjct: 394 gcattgacgcgtgatgctctcctttggtggaacgactggaaaagaagaaatcagagggca 453

                              
Query: 211 aaatggtgggattttgtga 229
           | ||||  |||||||||||
Sbjct: 454 acatggatggattttgtga 472