Miyakogusa Predicted Gene

Lj0g3v0097529.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0097529.1 tr|A1ZZN6|A1ZZN6_9BACT Outer membrane efflux
protein OS=Microscilla marina ATCC 23134
GN=M23134_0095,34.88,8,seg,NULL,CUFF.5431.1
         (282 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP085845 similar to UniRef100_Q0KIS1 Cluster: Retrotran...   115   1e-25

>gnl|LJGI|BP085845 similar to UniRef100_Q0KIS1 Cluster: Retrotransposon gag protein;
           n=1; Solanum demissum|Rep: Retrotransposon gag protein
           -, partial (0%)
          Length = 464

 Score =  115 bits (58), Expect = 1e-25
 Identities = 116/134 (86%), Gaps = 1/134 (0%)
 Strand = Plus / Minus

                                                                       
Query: 122 ctgagtctaagatgcattggatcgttcaaaatcttggagatggtttgtcctgtagcttat 181
           ||||||||||||| ||||||| |||| |||||||||||||||||||||| | ||||||||
Sbjct: 408 ctgagtctaagat-cattggaccgtttaaaatcttggagatggtttgtcttatagcttat 350

                                                                       
Query: 182 tgatctacattttccctatatctttttgcagctcatatagttcttcatgtttctatgctt 241
           ||||  |||   ||||| |||||||| |||||||| ||||||||||||||  || |||||
Sbjct: 349 tgattgacacactccctttatcttttggcagctcacatagttcttcatgtcactttgctt 290

                         
Query: 242 tgaagatacctata 255
           || ||| |||||||
Sbjct: 289 tggagaaacctata 276