Miyakogusa Predicted Gene

Lj0g3v0096019.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0096019.1 tr|B9I1T3|B9I1T3_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_568802 PE=4
SV=1,48.53,0.0000000003,seg,NULL,
gene.Ljchr0_pseudomol_20120828.path1.gene9457.1
         (216 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62332 weakly similar to UniRef100_Q9ZV99 Cluster: F9K...    50   5e-06

>gnl|LJGI|TC62332 weakly similar to UniRef100_Q9ZV99 Cluster: F9K20.15; n=1;
           Arabidopsis thaliana|Rep: F9K20.15 - Arabidopsis
           thaliana (Mouse-ear cress), partial (10%)
          Length = 1186

 Score = 50.1 bits (25), Expect = 5e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 41  cttattcacatgtcatctgcaaagttttgggttgggacatt 81
           ||||| ||||||||||||| |||||| | ||||||||||||
Sbjct: 766 cttatgcacatgtcatctgtaaagttgttggttgggacatt 806