Miyakogusa Predicted Gene

Lj0g3v0095939.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0095939.2 Non Chatacterized Hit- tr|B9G4R1|B9G4R1_ORYSJ
Putative uncharacterized protein OS=Oryza sativa
subsp,75.86,6e-18,PANTOTHENATE KINASE 4,NULL; PANTOTHENATE
KINASE,NULL; Fumble,Type II pantothenate kinase,CUFF.5329.2
         (336 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS325917 similar to UniRef100_Q8L5Y9 Cluster: Pantothen...   176   6e-44

>gnl|LJGI|FS325917 similar to UniRef100_Q8L5Y9 Cluster: Pantothenate kinase 2; n=2;
           Arabidopsis thaliana|Rep: Pantothenate kinase 2 -
           Arabidopsis thaliana (Mouse-ear cress), partial (24%)
          Length = 779

 Score =  176 bits (89), Expect = 6e-44
 Identities = 173/201 (86%)
 Strand = Plus / Plus

                                                                       
Query: 134 caattcacaggtctggttcaaggcctcagcttgatgtcagcaaagctgagattcaaggga 193
           |||||||||||||  ||||| |||| || || ||| | |||||||| | ||||||||| |
Sbjct: 98  caattcacaggtcgagttcacggccacaactggatcttagcaaagcagcgattcaaggaa 157

                                                                       
Query: 194 atgtggaggagaagtatcccaccattttgttgcctaatcaatctgatgatttgtctcacc 253
           ||||||| || | | ||||||| |||||||| ||||| |||||| ||||| | |||||  
Sbjct: 158 atgtggaagacagggatcccactattttgttacctaaccaatctcatgatatatctcatt 217

                                                                       
Query: 254 tggctcttgacattggaggatctttgataaagttggtgtacttttctagacatgaagacc 313
           ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||
Sbjct: 218 tggctcttgacattggagggtctttgataaagttggtgtacttttcaagacatgaagacc 277

                                
Query: 314 aatcagctgatgataaaagga 334
           | ||| || ||||||||||||
Sbjct: 278 attcaactaatgataaaagga 298