Miyakogusa Predicted Gene

Lj0g3v0093179.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0093179.1 Non Chatacterized Hit- tr|I1LUY5|I1LUY5_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.10890
PE,88.46,2e-19,SUBFAMILY NOT NAMED,NULL; FAMILY NOT
NAMED,NULL,CUFF.5116.1
         (180 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77965 homologue to UniRef100_Q9LKH8 Cluster: NADPH-pr...   315   5e-86
gnl|LJGI|TC67612 homologue to UniRef100_Q01289 Cluster: Protochl...   149   7e-36
gnl|LJGI|TC62248 similar to UniRef100_Q41249 Cluster: Protochlor...   149   7e-36
gnl|LJGI|TC70458 homologue to UniRef100_Q01289 Cluster: Protochl...   147   3e-35

>gnl|LJGI|TC77965 homologue to UniRef100_Q9LKH8 Cluster: NADPH-protochlorophyllide
           oxidoreductase; n=1; Vigna radiata var. radiata|Rep:
           NADPH-protochlorophyllide oxidoreductase - Phaseolus
           aureus (Mung bean) (Vigna radiata), partial (37%)
          Length = 768

 Score =  315 bits (159), Expect = 5e-86
 Identities = 159/159 (100%)
 Strand = Plus / Plus

                                                                       
Query: 22  caggttgtaggtgatccaagcctgacaaaatcaggtgtttactggagctggaacaaggat 81
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 287 caggttgtaggtgatccaagcctgacaaaatcaggtgtttactggagctggaacaaggat 346

                                                                       
Query: 82  tctgcttcatttgaaaatcagttgtcccaggaggccagtgatgcagataaggctcgcaag 141
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 347 tctgcttcatttgaaaatcagttgtcccaggaggccagtgatgcagataaggctcgcaag 406

                                                  
Query: 142 gtctgggagattagtgagaaacttgtaggtttggcttaa 180
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gtctgggagattagtgagaaacttgtaggtttggcttaa 445


>gnl|LJGI|TC67612 homologue to UniRef100_Q01289 Cluster: Protochlorophyllide
           reductase, chloroplast precursor; n=1; Pisum
           sativum|Rep: Protochlorophyllide reductase, chloroplast
           precursor - Pisum sativum (Garden pea), partial (39%)
          Length = 1381

 Score =  149 bits (75), Expect = 7e-36
 Identities = 135/155 (87%)
 Strand = Plus / Plus

                                                                       
Query: 22  caggttgtaggtgatccaagcctgacaaaatcaggtgtttactggagctggaacaaggat 81
           ||||||||  |||||||||| || |||||||| |||||||||||||||||||| ||    
Sbjct: 311 caggttgtgagtgatccaagtctcacaaaatctggtgtttactggagctggaataaaacc 370

                                                                       
Query: 82  tctgcttcatttgaaaatcagttgtcccaggaggccagtgatgcagataaggctcgcaag 141
           ||||||||||||||||| |||||||| ||||||||||| ||| | || ||||||||||||
Sbjct: 371 tctgcttcatttgaaaaccagttgtctcaggaggccagcgatcccgagaaggctcgcaag 430

                                              
Query: 142 gtctgggagattagtgagaaacttgtaggtttggc 176
           || |||||| ||||||||||||| || ||||||||
Sbjct: 431 gtgtgggaggttagtgagaaactagttggtttggc 465


>gnl|LJGI|TC62248 similar to UniRef100_Q41249 Cluster: Protochlorophyllide reductase,
            chloroplast precursor; n=3; Cucumis sativus|Rep:
            Protochlorophyllide reductase, chloroplast precursor -
            Cucumis sativus (Cucumber), complete
          Length = 1513

 Score =  149 bits (75), Expect = 7e-36
 Identities = 135/155 (87%)
 Strand = Plus / Plus

                                                                        
Query: 22   caggttgtaggtgatccaagcctgacaaaatcaggtgtttactggagctggaacaaggat 81
            ||||||||  |||||||||| || |||||||| |||||||||||||||||||| ||    
Sbjct: 1150 caggttgtgagtgatccaagtctcacaaaatctggtgtttactggagctggaataaaacc 1209

                                                                        
Query: 82   tctgcttcatttgaaaatcagttgtcccaggaggccagtgatgcagataaggctcgcaag 141
            ||||||||||||||||| |||||||| ||||||||||| ||| | || ||||||||||||
Sbjct: 1210 tctgcttcatttgaaaaccagttgtctcaggaggccagcgatcccgagaaggctcgcaag 1269

                                               
Query: 142  gtctgggagattagtgagaaacttgtaggtttggc 176
            || |||||| ||||||||||||| || ||||||||
Sbjct: 1270 gtgtgggaggttagtgagaaactagttggtttggc 1304


>gnl|LJGI|TC70458 homologue to UniRef100_Q01289 Cluster: Protochlorophyllide
           reductase, chloroplast precursor; n=1; Pisum
           sativum|Rep: Protochlorophyllide reductase, chloroplast
           precursor - Pisum sativum (Garden pea), partial (22%)
          Length = 542

 Score =  147 bits (74), Expect = 3e-35
 Identities = 134/154 (87%)
 Strand = Plus / Plus

                                                                       
Query: 23  aggttgtaggtgatccaagcctgacaaaatcaggtgtttactggagctggaacaaggatt 82
           |||||||  |||||||||| || |||||||| |||||||||||||||||||| ||    |
Sbjct: 180 aggttgtgagtgatccaagtctcacaaaatctggtgtttactggagctggaataaaacct 239

                                                                       
Query: 83  ctgcttcatttgaaaatcagttgtcccaggaggccagtgatgcagataaggctcgcaagg 142
           |||||||||||||||| |||||||| ||||||||||| ||| | || |||||||||||||
Sbjct: 240 ctgcttcatttgaaaaccagttgtctcaggaggccagcgatcccgagaaggctcgcaagg 299

                                             
Query: 143 tctgggagattagtgagaaacttgtaggtttggc 176
           | |||||| ||||||||||||| || ||||||||
Sbjct: 300 tgtgggaggttagtgagaaactagttggtttggc 333