Miyakogusa Predicted Gene
- Lj0g3v0089419.1
 
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0089419.1 Non Chatacterized Hit- tr|D7MVA0|D7MVA0_ARALL
Putative uncharacterized protein OS=Arabidopsis
lyrata,45.87,5e-19,N7-RELATED PROTEIN,NULL; F-BOX/LEUCINE RICH REPEAT
PROTEIN,NULL; no description,NULL; RNI-like,NULL,CUFF.4814.1
         (350 letters)
Database: LJGI 
           47,486 sequences; 32,788,469 total letters
Searching..................................................done
                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 ...   196   6e-50
gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-lik...    70   1e-11
gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyc...    50   9e-06
>gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 protein; n=1;
           Medicago truncatula|Rep: N7 protein - Medicago
           truncatula (Barrel medic), partial (34%)
          Length = 1017
 Score =  196 bits (99), Expect = 6e-50
 Identities = 253/303 (83%), Gaps = 1/303 (0%)
 Strand = Plus / Plus
                                                                       
Query: 39  attgagagaggctgtgacgaagcttcccatgttggaggagtttgaaatttcattcaaaca 98
           |||||| ||| |||||| |||||||||  |||||||||||||||||||||||||||  | 
Sbjct: 500 attgagtgagactgtgaagaagcttccactgttggaggagtttgaaatttcattcagccc 559
                                                                       
Query: 99  cttgtctaaggcttctttggaatttataggcaaatattgcccacatttgagtgtgctgaa 158
           | | |||||||   |||||||| | || ||||||| ||||||||||||||  ||||||||
Sbjct: 560 cctatctaaggacactttggaactcatgggcaaatgttgcccacatttgaaagtgctgaa 619
                                                                       
Query: 159 acttaacatgaaggaagtgaaaagcttcaagtttgatgatcaggcctttgcaattgcaaa 218
           | ||||||||| || | ||||| ||||  | | ||||||| |||| ||||| ||||||||
Sbjct: 620 atttaacatgaggggactgaaaggctttgaatgtgatgatgaggcatttgctattgcaaa 679
                                                                       
Query: 219 aaccatgcctcacctacgtcaactccagcttctgggaaacaggctcagtaatgaaggctt 278
           |||||||||||| ||  |||| || |||||| ||||||||||||||| |||| | |||||
Sbjct: 680 aaccatgcctcagctgtgtcatcttcagcttttgggaaacaggctcactaataacggctt 739
                                                                       
Query: 279 gcttgccattcttgacggatgccctcatcttg-atctcttgatctttgtgtttgttccaa 337
           | |||| |||||||| || ||||||||||||| ||||||||| ||  ||| |||||| ||
Sbjct: 740 gattgctattcttgatgggtgccctcatcttgaatctcttgacctgcgtgcttgttctaa 799
              
Query: 338 tgt 340
           |||
Sbjct: 800 tgt 802
>gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (37%)
          Length = 840
 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 74/87 (85%)
 Strand = Plus / Plus
                                                                       
Query: 218 aaaccatgcctcacctacgtcaactccagcttctgggaaacaggctcagtaatgaaggct 277
           |||| |||||| | || ||||| || ||| || |||||||||| ||||||||||| ||||
Sbjct: 340 aaacaatgcctgagctgcgtcacctacagattatgggaaacagtctcagtaatgatggct 399
                                      
Query: 278 tgcttgccattcttgacggatgccctc 304
           ||||||| |||||||| || |||||||
Sbjct: 400 tgcttgctattcttgatggttgccctc 426
>gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (28%)
          Length = 823
 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 43/49 (87%)
 Strand = Plus / Plus
                                                            
Query: 263 tcagtaatgaaggcttgcttgccattcttgacggatgccctcatcttga 311
           |||||||||||||||||  |||||||||||| || || |||| ||||||
Sbjct: 365 tcagtaatgaaggcttggatgccattcttgatggttgtcctcttcttga 413