Miyakogusa Predicted Gene
- Lj0g3v0089419.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0089419.1 Non Chatacterized Hit- tr|D7MVA0|D7MVA0_ARALL
Putative uncharacterized protein OS=Arabidopsis
lyrata,45.87,5e-19,N7-RELATED PROTEIN,NULL; F-BOX/LEUCINE RICH REPEAT
PROTEIN,NULL; no description,NULL; RNI-like,NULL,CUFF.4814.1
(350 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 ... 196 6e-50
gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-lik... 70 1e-11
gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyc... 50 9e-06
>gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 protein; n=1;
Medicago truncatula|Rep: N7 protein - Medicago
truncatula (Barrel medic), partial (34%)
Length = 1017
Score = 196 bits (99), Expect = 6e-50
Identities = 253/303 (83%), Gaps = 1/303 (0%)
Strand = Plus / Plus
Query: 39 attgagagaggctgtgacgaagcttcccatgttggaggagtttgaaatttcattcaaaca 98
|||||| ||| |||||| ||||||||| ||||||||||||||||||||||||||| |
Sbjct: 500 attgagtgagactgtgaagaagcttccactgttggaggagtttgaaatttcattcagccc 559
Query: 99 cttgtctaaggcttctttggaatttataggcaaatattgcccacatttgagtgtgctgaa 158
| | ||||||| |||||||| | || ||||||| |||||||||||||| ||||||||
Sbjct: 560 cctatctaaggacactttggaactcatgggcaaatgttgcccacatttgaaagtgctgaa 619
Query: 159 acttaacatgaaggaagtgaaaagcttcaagtttgatgatcaggcctttgcaattgcaaa 218
| ||||||||| || | ||||| |||| | | ||||||| |||| ||||| ||||||||
Sbjct: 620 atttaacatgaggggactgaaaggctttgaatgtgatgatgaggcatttgctattgcaaa 679
Query: 219 aaccatgcctcacctacgtcaactccagcttctgggaaacaggctcagtaatgaaggctt 278
|||||||||||| || |||| || |||||| ||||||||||||||| |||| | |||||
Sbjct: 680 aaccatgcctcagctgtgtcatcttcagcttttgggaaacaggctcactaataacggctt 739
Query: 279 gcttgccattcttgacggatgccctcatcttg-atctcttgatctttgtgtttgttccaa 337
| |||| |||||||| || ||||||||||||| ||||||||| || ||| |||||| ||
Sbjct: 740 gattgctattcttgatgggtgccctcatcttgaatctcttgacctgcgtgcttgttctaa 799
Query: 338 tgt 340
|||
Sbjct: 800 tgt 802
>gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (37%)
Length = 840
Score = 69.9 bits (35), Expect = 1e-11
Identities = 74/87 (85%)
Strand = Plus / Plus
Query: 218 aaaccatgcctcacctacgtcaactccagcttctgggaaacaggctcagtaatgaaggct 277
|||| |||||| | || ||||| || ||| || |||||||||| ||||||||||| ||||
Sbjct: 340 aaacaatgcctgagctgcgtcacctacagattatgggaaacagtctcagtaatgatggct 399
Query: 278 tgcttgccattcttgacggatgccctc 304
||||||| |||||||| || |||||||
Sbjct: 400 tgcttgctattcttgatggttgccctc 426
>gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (28%)
Length = 823
Score = 50.1 bits (25), Expect = 9e-06
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 263 tcagtaatgaaggcttgcttgccattcttgacggatgccctcatcttga 311
||||||||||||||||| |||||||||||| || || |||| ||||||
Sbjct: 365 tcagtaatgaaggcttggatgccattcttgatggttgtcctcttcttga 413