Miyakogusa Predicted Gene

Lj0g3v0088019.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0088019.1 tr|G7LII2|G7LII2_MEDTR Lectin receptor-like
kinase Tg-20 OS=Medicago truncatula GN=MTR_8g068050
PE=3,78.23,0,seg,NULL; SUBFAMILY NOT NAMED,NULL; FAMILY NOT
NAMED,NULL; no description,Concanavalin A-like lectin,CUFF.4708.1
         (1980 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS362035 similar to UniRef100_Q6UY57 Cluster: Lectin-li...    62   1e-08
gnl|LJGI|TC76027 similar to UniRef100_A7R359 Cluster: Chromosome...    56   9e-07

>gnl|LJGI|FS362035 similar to UniRef100_Q6UY57 Cluster: Lectin-like receptor kinase 1;1;
            n=1; Medicago truncatula|Rep: Lectin-like receptor kinase
            1;1 - Medicago truncatula (Barrel medic), partial (26%)
          Length = 612

 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                        
Query: 1181 tagggtggtgtcatgagcaaggagagcttcttcttgtttatgaatacatgcctaatggaa 1240
            ||||||||||||||||| |||||||| || | ||||||| ||| ||||||   |||||||
Sbjct: 265  tagggtggtgtcatgaggaaggagagtttttgcttgtttttgagtacatgatgaatggaa 206

                   
Query: 1241 gccttga 1247
            |||||||
Sbjct: 205  gccttga 199


>gnl|LJGI|TC76027 similar to UniRef100_A7R359 Cluster: Chromosome undetermined
            scaffold_484, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome undetermined scaffold_484, whole
            genome shotgun sequence - Vitis vinifera (Grape), partial
            (38%)
          Length = 866

 Score = 56.0 bits (28), Expect = 9e-07
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                        
Query: 1213 cttgtttatgaatacatgcctaatggaa 1240
            ||||||||||||||||||||||||||||
Sbjct: 429  cttgtttatgaatacatgcctaatggaa 456