Miyakogusa Predicted Gene

Lj0g3v0086419.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0086419.1 tr|G7IB93|G7IB93_MEDTR BEL1-like homeodomain
protein OS=Medicago truncatula GN=MTR_1g016490 PE=3 SV=,64.79,0,no
description,Homeodomain-like; HOMEOBOX PROTEIN KNOTTED-1-RELATED,NULL;
HOMEOBOX PROTEIN TRANSCRIP,CUFF.4589.1
         (1632 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV419283 homologue to UniRef100_Q8LLD9 Cluster: BEL1-re...    58   2e-07

>gnl|LJGI|AV419283 homologue to UniRef100_Q8LLD9 Cluster: BEL1-related homeotic protein
            29; n=1; Solanum tuberosum|Rep: BEL1-related homeotic
            protein 29 - Solanum tuberosum (Potato), partial (6%)
          Length = 155

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1462 caggtatcgaactggtttataaatgcccgtgttcggctatggaaaccaatgatagaggaa 1521
            ||||||||||| |||||||| |||||  | ||  |||||||||| |||||| ||||||||
Sbjct: 3    caggtatcgaaatggtttatcaatgcaagggtgaggctatggaagccaatggtagaggaa 62

                 
Query: 1522 atgta 1526
            |||||
Sbjct: 63   atgta 67