Miyakogusa Predicted Gene

Lj0g3v0084419.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0084419.1 Non Chatacterized Hit- tr|H2LVS0|H2LVS0_ORYLA
Uncharacterized protein (Fragment) OS=Oryzias latipes
,32.53,0.21,seg,NULL,CUFF.4428.1
         (481 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS338862 similar to UniRef100_Q13BJ2 Cluster: Chaperone...   184   3e-46
gnl|LJGI|TC79520                                                      170   5e-42
gnl|LJGI|TC76763 similar to UniRef100_Q9EMA1 Cluster: Envelope g...   155   3e-37
gnl|LJGI|FS350483                                                     111   4e-24
gnl|LJGI|TC70244 weakly similar to UniRef100_Q9BQ87 Cluster: F-b...    70   1e-11

>gnl|LJGI|FS338862 similar to UniRef100_Q13BJ2 Cluster: Chaperone DnaJ-like; n=1;
           Rhodopseudomonas palustris BisB5|Rep: Chaperone
           DnaJ-like - Rhodopseudomonas palustris (strain BisB5),
           partial (6%)
          Length = 226

 Score =  184 bits (93), Expect = 3e-46
 Identities = 99/101 (98%)
 Strand = Plus / Minus

                                                                       
Query: 378 ggtgatgggtgggagtgggatgagaagaaggaagaagaagatgaagggaattatgggtgc 437
           |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 170 ggtgttgggtgggagtgtgatgagaagaaggaagaagaagatgaagggaattatgggtgc 111

                                                    
Query: 438 ctgggttttgaagatgaagaaaatggttaaatttctaggtt 478
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 110 ctgggttttgaagatgaagaaaatggttaaatttctaggtt 70


>gnl|LJGI|TC79520 
          Length = 695

 Score =  170 bits (86), Expect = 5e-42
 Identities = 93/94 (98%), Gaps = 1/94 (1%)
 Strand = Plus / Minus

                                                                       
Query: 385 ggtgggagtgggatgagaagaaggaagaagaagatgaagggaattatgggtgcctgggtt 444
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 200 ggtgggagtgggatgagaagaaggaagaagaagatgaagggaattat-ggtgcctgggtt 142

                                             
Query: 445 ttgaagatgaagaaaatggttaaatttctaggtt 478
           ||||||||||||||||||||||||||||||||||
Sbjct: 141 ttgaagatgaagaaaatggttaaatttctaggtt 108


>gnl|LJGI|TC76763 similar to UniRef100_Q9EMA1 Cluster: Envelope glycoprotein; n=1;
           Human immunodeficiency virus 1|Rep: Envelope
           glycoprotein - Human immunodeficiency virus 1, partial
           (12%)
          Length = 470

 Score =  155 bits (78), Expect = 3e-37
 Identities = 91/94 (96%), Gaps = 1/94 (1%)
 Strand = Plus / Minus

                                                                       
Query: 385 ggtgggagtgggatgagaagaaggaagaagaagatgaagggaattatgggtgcctgggtt 444
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 259 ggtgggagtgggatgagaagaaggaagaagaagatgaagggaattat-ggtgcctgggtt 201

                                             
Query: 445 ttgaagatgaagaaaatggttaaatttctaggtt 478
           |||||||||||||||| |||||||||| ||||||
Sbjct: 200 ttgaagatgaagaaaagggttaaatttataggtt 167


>gnl|LJGI|FS350483 
          Length = 650

 Score =  111 bits (56), Expect = 4e-24
 Identities = 65/68 (95%)
 Strand = Plus / Minus

                                                                       
Query: 411 gaagaagatgaagggaattatgggtgcctgggttttgaagatgaagaaaatggttaaatt 470
           ||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 604 gaagaagatgaagagaattatgggtgtctgggtttttaagatgaagaaaatggttaaatt 545

                   
Query: 471 tctaggtt 478
           ||||||||
Sbjct: 544 tctaggtt 537


>gnl|LJGI|TC70244 weakly similar to UniRef100_Q9BQ87 Cluster: F-box-like/WD
           repeat-containing protein TBL1Y; n=2; Homo sapiens|Rep:
           F-box-like/WD repeat-containing protein TBL1Y - Homo
           sapiens (Human), partial (4%)
          Length = 701

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 67  atttcaacccaccccctcttctctctgataatggcgatcccacccaccgccgcca 121
           ||||||||||||||||||||||||||||  |||  ||||||||||||| ||||||
Sbjct: 262 atttcaacccaccccctcttctctctgaccatgcagatcccacccaccaccgcca 208