Miyakogusa Predicted Gene
- Lj0g3v0084339.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0084339.1 Non Chatacterized Hit- tr|G7JS00|G7JS00_MEDTR
Putative uncharacterized protein OS=Medicago truncatul,56.25,0.000002,
,CUFF.4422.1
(367 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC62726 similar to UniRef100_Q850H7 Cluster: Gag-pol po... 165 2e-40
gnl|LJGI|TC79059 58 4e-08
>gnl|LJGI|TC62726 similar to UniRef100_Q850H7 Cluster: Gag-pol polyprotein; n=1;
Vitis vinifera|Rep: Gag-pol polyprotein - Vitis vinifera
(Grape), partial (41%)
Length = 855
Score = 165 bits (83), Expect = 2e-40
Identities = 232/277 (83%), Gaps = 6/277 (2%)
Strand = Plus / Minus
Query: 13 caatccaccacaatatgtttatttctttcattaaaaaa-ggatttgatgagatatgtatg 71
||||||||| ||||||||||| ||||||||| ||||| |||||||| |||||||| | |
Sbjct: 463 caatccacctcaatatgtttagttctttcatgaaaaactggatttgacgagatatgaagg 404
Query: 72 gcagcccgattatcacaccaaagtttcatcgcacatg--ctctcaattcgcagctc--ta 127
|||||| ||||||||||||| |||||||| | | || |||||||||| || || |
Sbjct: 403 gcagcctgattatcacaccatagtttcattggagatatcctctcaattcccatgtcactc 344
Query: 128 aagatctccccaaaccacataagttcacaggtattttgagtcatcgcccgatattcagct 187
||||| | || | ||||||||||||||| ||| |||||| ||| || ||||||||||||
Sbjct: 343 aagatttgtcctacccacataagttcacatgtagtttgagccatagcacgatattcagct 284
Query: 188 ta-gcacttgattgtgtcatcacattttgcttcttgcttttccatgatattaaattccct 246
| ||||| ||| ||| || |||||||||||||||||||||||| || |||||||| |||
Sbjct: 283 tctgcactagatcgtgccaccacattttgcttcttgcttttccaagaaattaaattacct 224
Query: 247 tccaaaagtacacaacagccaatggtggattttctat 283
|||||| ||||||| ||||| |||||||||||||||
Sbjct: 223 cccaaaaatacacaatagccagtggtggattttctat 187
>gnl|LJGI|TC79059
Length = 479
Score = 58.0 bits (29), Expect = 4e-08
Identities = 38/41 (92%)
Strand = Plus / Minus
Query: 51 ggatttgatgagatatgtatggcagcccgattatcacacca 91
||||| ||||||||||||| ||||||| |||||||||||||
Sbjct: 100 ggattggatgagatatgtagggcagcctgattatcacacca 60