Miyakogusa Predicted Gene
- Lj0g3v0083999.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0083999.1 Non Chatacterized Hit- tr|I3TA90|I3TA90_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=4
SV=1,100,4.06377e-44,PLP-dependent transferases,Pyridoxal
phosphate-dependent transferase, major domain; SUBFAMILY NOT
NA,gene.Ljchr0_pseudomol_20120828.path1.gene8065.1
(261 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59683 similar to UniRef100_Q42803 Cluster: Mitochondr... 517 e-146
>gnl|LJGI|TC59683 similar to UniRef100_Q42803 Cluster: Mitochondrial aspartate
aminotransferase precursor; n=1; Glycine max|Rep:
Mitochondrial aspartate aminotransferase precursor -
Glycine max (Soybean), partial (94%)
Length = 1773
Score = 517 bits (261), Expect = e-146
Identities = 261/261 (100%)
Strand = Plus / Plus
Query: 1 atggcagatcgtatcattggaatgaggaccacactccgtgataacttagaaaagctgggt 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1098 atggcagatcgtatcattggaatgaggaccacactccgtgataacttagaaaagctgggt 1157
Query: 61 tctcctttgccatggcagcacataaccaatcagattggaatgttctgctacactgggttg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1158 tctcctttgccatggcagcacataaccaatcagattggaatgttctgctacactgggttg 1217
Query: 121 acaccagaacaggttgatcgtttgacaaacgagtttcatatttacttgactcgcaacggt 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1218 acaccagaacaggttgatcgtttgacaaacgagtttcatatttacttgactcgcaacggt 1277
Query: 181 cgtatcagtatggctggaattaattcggggaacgttgcatatgtggctaatgctatcaac 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1278 cgtatcagtatggctggaattaattcggggaacgttgcatatgtggctaatgctatcaac 1337
Query: 241 gaggtcactaaatcttcctag 261
|||||||||||||||||||||
Sbjct: 1338 gaggtcactaaatcttcctag 1358