Miyakogusa Predicted Gene
- Lj0g3v0083669.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0083669.1 Non Chatacterized Hit- tr|G7IGQ6|G7IGQ6_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,26.24,0.0000000002,RNA-binding domain, RBD,NULL; seg,NULL;
no description,Nucleotide-binding, alpha-beta plait;
RRM_1,R,CUFF.4384.1
(984 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS337198 similar to UniRef100_A4EVZ5 Cluster: Drug resi... 355 3e-97
>gnl|LJGI|FS337198 similar to UniRef100_A4EVZ5 Cluster: Drug resistance transporter
Bcr/CflA subfamily protein; n=1; Roseobacter sp.
SK209-2-6|, partial (4%)
Length = 260
Score = 355 bits (179), Expect = 3e-97
Identities = 179/179 (100%)
Strand = Plus / Plus
Query: 1 atggtcgtgaagggtagggactctgctagggtttcgactgcttggagggatggtggtaga 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82 atggtcgtgaagggtagggactctgctagggtttcgactgcttggagggatggtggtaga 141
Query: 61 tggcaaggtggagtcactttatttgttgatggtttgagtgccagatcaaattacagacat 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 tggcaaggtggagtcactttatttgttgatggtttgagtgccagatcaaattacagacat 201
Query: 121 gtgcgaagtatgtttgagaattttggaaaggtggagaggctcttcatctcgagaagcac 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 gtgcgaagtatgtttgagaattttggaaaggtggagaggctcttcatctcgagaagcac 260