Miyakogusa Predicted Gene

Lj0g3v0083479.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0083479.2 Non Chatacterized Hit- tr|I1N107|I1N107_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.53828 PE,51.67,3e-19,
,CUFF.4371.2
         (335 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67405 similar to UniRef100_Q948P0 Cluster: Aspartic p...    80   1e-14
gnl|LJGI|TC70744                                                       68   4e-11
gnl|LJGI|TC79661                                                       60   9e-09
gnl|LJGI|TC79425                                                       60   9e-09

>gnl|LJGI|TC67405 similar to UniRef100_Q948P0 Cluster: Aspartic proteinase 2; n=1;
           Glycine max|Rep: Aspartic proteinase 2 - Glycine max
           (Soybean), partial (4%)
          Length = 1013

 Score = 79.8 bits (40), Expect = 1e-14
 Identities = 61/68 (89%)
 Strand = Plus / Plus

                                                                       
Query: 113 tatcttcagatgatggtgatgtgaagaaaatcaagtcaccaaataaccaaagtgcatgta 172
           ||||||||||||||||  || ||||| |||||||||||||||||||||||  ||||||||
Sbjct: 608 tatcttcagatgatgggcatatgaagcaaatcaagtcaccaaataaccaatttgcatgta 667

                   
Query: 173 aaccatca 180
           || |||||
Sbjct: 668 aatcatca 675



 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 24  ccttcttactgaaaagaaggcagcttcagttactccctggccaggcacagaaact 78
           ||||| ||||||||||||||||||||||||||  || ||||||| |||| |||||
Sbjct: 498 ccttcatactgaaaagaaggcagcttcagttagaccttggccagccacataaact 552


>gnl|LJGI|TC70744 
          Length = 860

 Score = 67.9 bits (34), Expect = 4e-11
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 24  ccttcttactgaaaagaaggcagcttcagttactccctggccaggcacagaaactgagag 83
           ||||| ||||||||||||||||||||||||||| || |||||   |||| ||||| ||||
Sbjct: 447 ccttcatactgaaaagaaggcagcttcagttacaccttggcctaccacataaactaagag 506

                 
Query: 84  gaagaa 89
           ||||||
Sbjct: 507 gaagaa 512


>gnl|LJGI|TC79661 
          Length = 388

 Score = 60.0 bits (30), Expect = 9e-09
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 120 agatgatggtgatgtgaagaaaatcaagtcaccaaataaccaaagtgcatgtaaaccatc 179
           |||||||||  || ||||| ||| |||| ||||| |||||||||||||||||||||| ||
Sbjct: 149 agatgatgggcatatgaagcaaaacaagacaccacataaccaaagtgcatgtaaaccctc 208

                         
Query: 180 accttatcctaccc 193
           |   ||||||||||
Sbjct: 209 attgtatcctaccc 222


>gnl|LJGI|TC79425 
          Length = 700

 Score = 60.0 bits (30), Expect = 9e-09
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 24  ccttcttactgaaaagaaggcagcttcagttactccctggcc 65
           ||||| ||||||||||||||||||||||||||| || |||||
Sbjct: 332 ccttcatactgaaaagaaggcagcttcagttacaccttggcc 373