Miyakogusa Predicted Gene
- Lj0g3v0081459.3
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0081459.3 tr|I1L4X3|I1L4X3_SOYBN Ubiquitin
carboxyl-terminal hydrolase (Fragment) OS=Glycine max PE=3
SV=1,65.83,0,UCH_2_3,Peptidase C19, ubiquitin carboxyl-terminal
hydrolase 2; seg,NULL; Cysteine proteinases,NULL;,CUFF.4229.3
(642 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC69611 similar to UniRef100_A7PC87 Cluster: Ubiquitin ... 317 5e-86
>gnl|LJGI|TC69611 similar to UniRef100_A7PC87 Cluster: Ubiquitin carboxyl-terminal
hydrolase; n=1; Vitis vinifera|Rep: Ubiquitin
carboxyl-terminal hydrolase - Vitis vinifera (Grape),
partial (5%)
Length = 524
Score = 317 bits (160), Expect = 5e-86
Identities = 163/164 (99%)
Strand = Plus / Plus
Query: 479 ccagtgtatccggagatgaagtcttgtctcaagaagcatacatcctggtttatgcacgac 538
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 1 ccagtgtatccggagatgaagtcttgtctcaagaagcatacatcctgttttatgcacgac 60
Query: 539 aaggaacaccatggttttcgagtattatggaggatgtaaactcatcatatcaacactcag 598
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 aaggaacaccatggttttcgagtattatggaggatgtaaactcatcatatcaacactcag 120
Query: 599 gttcaggcaacaaaggtgattgtggtggtaatgaacaaatggaa 642
||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gttcaggcaacaaaggtgattgtggtggtaatgaacaaatggaa 164