Miyakogusa Predicted Gene

Lj0g3v0079589.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0079589.1 tr|E3GQC8|E3GQC8_EUBLK Sodium/sulfate symporter
OS=Eubacterium limosum (strain KIST612) GN=ELI_4280
,31.33,1.1,seg,NULL,NODE_64857_length_849_cov_8.678445.path1.1
         (462 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64941 similar to UniRef100_A9JFQ7 Cluster: 4Fe-4S fer...   502   e-141

>gnl|LJGI|TC64941 similar to UniRef100_A9JFQ7 Cluster: 4Fe-4S ferredoxin, iron-sulfur
           binding domain protein; n=1; Desulfatibacillum
           alkenivorans AK-01|Rep: 4Fe-4S ferredoxin, iron-sulfur
           binding domain protein - Desulfatibacillum alkenivorans
           AK-01, partial (12%)
          Length = 632

 Score =  502 bits (253), Expect = e-141
 Identities = 253/253 (100%)
 Strand = Plus / Minus

                                                                       
Query: 210 ggcgatggtctccctgtgtgcccaaatcgagctcttcaccttcatccttctgacgaccta 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 546 ggcgatggtctccctgtgtgcccaaatcgagctcttcaccttcatccttctgacgaccta 487

                                                                       
Query: 270 ctccctatgtgcccagatcgagctcttcacctacatctctgattcgagcttccgcccacg 329
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 486 ctccctatgtgcccagatcgagctcttcacctacatctctgattcgagcttccgcccacg 427

                                                                       
Query: 330 ctggttctggcaacggagcttttgcgttttcggttgcacgtcccgtgatgttcttcaacg 389
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 426 ctggttctggcaacggagcttttgcgttttcggttgcacgtcccgtgatgttcttcaacg 367

                                                                       
Query: 390 cgtttgctcgtccgaagaccatgctgagcattggtcaccgcgagatgtgcgggttcgatc 449
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 366 cgtttgctcgtccgaagaccatgctgagcattggtcaccgcgagatgtgcgggttcgatc 307

                        
Query: 450 tcccggtggctga 462
           |||||||||||||
Sbjct: 306 tcccggtggctga 294



 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 125 atgttcccttcacttgctctgtaattg 151
           |||||||||||||||||||||||||||
Sbjct: 631 atgttcccttcacttgctctgtaattg 605