Miyakogusa Predicted Gene
- Lj0g3v0076849.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0076849.1 tr|G7LFI2|G7LFI2_MEDTR F-box protein OS=Medicago
truncatula GN=MTR_8g063440 PE=4 SV=1,50.13,0,F_box_assoc_1: F-box
protein interaction domain,F-box associated interaction domain;
seg,NULL; A Rec,CUFF.3905.1
(1183 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO010439 similar to UniRef100_A2Q609 Cluster: Cyclin-li... 107 2e-22
gnl|LJGI|TC77125 weakly similar to UniRef100_A2Q228 Cluster: Cyc... 98 2e-19
>gnl|LJGI|GO010439 similar to UniRef100_A2Q609 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (18%)
Length = 736
Score = 107 bits (54), Expect = 2e-22
Identities = 125/146 (85%), Gaps = 2/146 (1%)
Strand = Plus / Plus
Query: 71 tgtcgaagctgcctctcaaatctcttaaccgattcac-ctgcgtacacaaatcatgggct 129
||||||| |||||||| |||||||| || |||||||| ||| || ||||||||||||| |
Sbjct: 71 tgtcgaaactgcctctgaaatctctcaagcgattcacactg-gttcacaaatcatgggtt 129
Query: 130 ggtttacttcaaaacccttatttcatgaccattttccgcgccaatttcctatccaagcat 189
| ||||| | ||| |||||||||||||| ||| || ||| ||||||| ||||||| |||
Sbjct: 130 gatttacatgaaatcccttatttcatgagcatgtttcgcagcaatttcttatccaaacat 189
Query: 190 cactcttattacaatgatacatctct 215
|| ||||||||| |||||||||||||
Sbjct: 190 caatcttattacgatgatacatctct 215
Score = 81.8 bits (41), Expect = 9e-15
Identities = 53/57 (92%)
Strand = Plus / Plus
Query: 406 aagtttgtattgtggaacccagctactgaggaattcagaattattcctcccagccct 462
|||| |||||||||||||||||||||||| ||||||||| ||| |||||||||||||
Sbjct: 403 aagtatgtattgtggaacccagctactgaagaattcagagttactcctcccagccct 459
Score = 75.8 bits (38), Expect = 6e-13
Identities = 38/38 (100%)
Strand = Plus / Plus
Query: 625 tgggagatatatagcctaagaagcaactcttggaggaa 662
||||||||||||||||||||||||||||||||||||||
Sbjct: 699 tgggagatatatagcctaagaagcaactcttggaggaa 736
>gnl|LJGI|TC77125 weakly similar to UniRef100_A2Q228 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago truncatula|Rep:
Cyclin-like F-box; F-box protein interaction domain -
Medicago truncatula (Barrel medic), partial (32%)
Length = 1362
Score = 97.6 bits (49), Expect = 2e-19
Identities = 265/336 (78%), Gaps = 12/336 (3%)
Strand = Plus / Plus
Query: 776 atttggcgtcatttaacttgagcaatgaggttttccttacaacacccttaccgtttgatc 835
|||||| |||||| ||||| ||||||||| | ||| ||||| ||||||||||| ||||
Sbjct: 795 atttggggtcattcaactttagcaatgagatattctacacaacgcccttaccgttagatc 854
Query: 836 tgggtgatagatcgctgcagaaatgcttggtggtgttaaatgggtccattgctgtgatat 895
||| ||||| | | |||||| | ||||| |||||||||| ||||||||| ||||||
Sbjct: 855 tggctgatacagggaagcagaactacttggcagtgttaaatgagtccattgcattgatat 914
Query: 896 cagaatctgcaga---aacaacttttcacatttcaattttgggtgaactcggtgtgaagg 952
|| | || ||| ||||||||||||||| | ||||||||||| ||| ||| ||||
Sbjct: 915 caatacatgaagaaacaacaacttttcacatatggattttgggtgagctctgtgcaaagg 974
Query: 953 aatcgtggactaaacttttcact------attggacctttgccttgggttgggtttccta 1006
|||| |||||||||||||||||| ||||||| |||| | | ||||| ||||||
Sbjct: 975 aatcatggactaaacttttcactgttggacttggacccttgcatggctttgggcttccta 1034
Query: 1007 ttggggtggggaataagggtgatgtattcttaagaaaagaagaaaaaggggaactagctt 1066
|||| || ||||| | ||| ||| ||||||| |||| ||||||| || |||||||| |
Sbjct: 1035 ttggagtagggaagatgggcgatatattcttcagaa---aagaaaatggtgaactagcct 1091
Query: 1067 tgtttgatttaagttcccagatgctcgaggatattg 1102
|||| ||||||||| | || |||||| |||| ||||
Sbjct: 1092 tgttcgatttaagtactcatatgctcaaggagattg 1127
Score = 91.7 bits (46), Expect = 9e-18
Identities = 58/62 (93%)
Strand = Plus / Plus
Query: 625 tgggagatatatagcctaagaagcaactcttggaggaaacttgatgctcatatgcctatt 684
||||| ||||||||||||||||||||||||||||||||||| ||| || |||||||||||
Sbjct: 647 tgggaaatatatagcctaagaagcaactcttggaggaaactggatactgatatgcctatt 706
Query: 685 at 686
||
Sbjct: 707 at 708
Score = 75.8 bits (38), Expect = 6e-13
Identities = 53/58 (91%)
Strand = Plus / Plus
Query: 406 aagtttgtattgtggaacccagctactgaggaattcagaattattcctcccagccctc 463
|||| |||||||||||||||||||||| | ||||||||| ||| ||||||||||||||
Sbjct: 347 aagtatgtattgtggaacccagctactaatgaattcagagttactcctcccagccctc 404
Score = 56.0 bits (28), Expect = 5e-07
Identities = 75/88 (85%), Gaps = 2/88 (2%)
Strand = Plus / Plus
Query: 71 tgtcgaagctgcctctcaaatctcttaaccgattcac-ctgcgtacacaaatcatgggct 129
||||||| |||||||| ||||| || || |||||||| ||| || |||||||||||||||
Sbjct: 27 tgtcgaaactgcctctgaaatccctcaagcgattcacactg-gttcacaaatcatgggct 85
Query: 130 ggtttacttcaaaacccttatttcatga 157
| |||||| ||| |||| |||||||||
Sbjct: 86 gatttactcgaaatccctcatttcatga 113
Score = 54.0 bits (27), Expect = 2e-06
Identities = 47/53 (88%), Gaps = 3/53 (5%)
Strand = Plus / Plus
Query: 179 tatccaagcatcactcttattacaatgatacatct---cttctcttacagcag 228
||||||| |||||||||||| || ||||||||||| |||||||||||||||
Sbjct: 123 tatccaaacatcactcttatcacgatgatacatctttccttctcttacagcag 175