Miyakogusa Predicted Gene
- Lj0g3v0076589.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0076589.1 tr|G7J8F3|G7J8F3_MEDTR F-box family protein
OS=Medicago truncatula GN=MTR_3g105060 PE=4
SV=1,31.43,3e-18,FBOX,F-box domain, cyclin-like; F-box-like,NULL;
LRR_2,Leucine-rich repeat 2; no description,NULL; F,gene.g5641.t1.1
(1092 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC71561 similar to UniRef100_A2Q1U7 Cluster: Cyclin-lik... 54 2e-06
>gnl|LJGI|TC71561 similar to UniRef100_A2Q1U7 Cluster: Cyclin-like F-box; FBD; n=1;
Medicago truncatula|Rep: Cyclin-like F-box; FBD -
Medicago truncatula (Barrel medic), partial (18%)
Length = 485
Score = 54.0 bits (27), Expect = 2e-06
Identities = 51/59 (86%)
Strand = Plus / Plus
Query: 13 gataggatcagcgatttaccggatgaaatattgtgccacatactctcttttctcccgac 71
||||||||||||| ||||||||| ||||| | |||||||| || || |||||||||||
Sbjct: 72 gataggatcagcgctttaccggacgaaatcatctgccacattctatcgtttctcccgac 130