Miyakogusa Predicted Gene

Lj0g3v0075969.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0075969.1 tr|G7IYP6|G7IYP6_MEDTR F-box/kelch-repeat protein
OS=Medicago truncatula GN=MTR_3g013950 PE=4 SV=1,43.16,0.000002,
,CUFF.3823.1
         (273 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW594747 similar to UniRef100_Q0GJI6 Cluster: SLF-like ...    72   2e-12
gnl|LJGI|TC57901 similar to UniRef100_A2Q2H0 Cluster: F-box prot...    58   3e-08

>gnl|LJGI|BW594747 similar to UniRef100_Q0GJI6 Cluster: SLF-like protein 1; n=1;
           Antirrhinum majus|Rep: SLF-like protein 1 - Antirrhinum
           majus, partial (4%)
          Length = 480

 Score = 71.9 bits (36), Expect = 2e-12
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 1   atgagagagtatggagttcgggagtcttggacttggttggtgagtgtcagctatga 56
           ||||||||||| || ||||| |||||||||||| | ||||||||||||||||||||
Sbjct: 179 atgagagagtacggtgttcgagagtcttggactcgattggtgagtgtcagctatga 234


>gnl|LJGI|TC57901 similar to UniRef100_A2Q2H0 Cluster: F-box protein interaction
           domain; n=1; Medicago truncatula|Rep: F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (9%)
          Length = 1406

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 1   atgagagagtatggagttcgggagtcttggacttggttggt 41
           ||||||||||| |||||||| |||||||||||| |||||||
Sbjct: 925 atgagagagtacggagttcgtgagtcttggactcggttggt 965



 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 172  tataatctcagagataatagtgtgaagtgtattcaacttccc 213
            |||||||| |||||||||||||||||   |||||||||||||
Sbjct: 1090 tataatctaagagataatagtgtgaaacatattcaacttccc 1131