Miyakogusa Predicted Gene
- Lj0g3v0074579.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0074579.1 Non Chatacterized Hit- tr|I1N5E8|I1N5E8_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,93.1,0.000002,
,CUFF.3728.1
(159 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC77041 homologue to UniRef100_A2Q4X4 Cluster: Epsin, N... 143 4e-34
>gnl|LJGI|TC77041 homologue to UniRef100_A2Q4X4 Cluster: Epsin, N-terminal; ENTH/VHS;
n=1; Medicago truncatula|Rep: Epsin, N-terminal;
ENTH/VHS - Medicago truncatula (Barrel medic), partial
(26%)
Length = 988
Score = 143 bits (72), Expect = 4e-34
Identities = 84/88 (95%)
Strand = Plus / Plus
Query: 1 atgaagaaggttattggtcaaattgttagggaccttaagagagaagtgaataagaaagtg 60
|||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||
Sbjct: 174 atgaagaaggttatcggtcaaactgttcgggaccttaagagagaagtgaataagaaagtg 233
Query: 61 ctgaaagtcactgggattgaacagaagg 88
||||||||| ||||||||||||||||||
Sbjct: 234 ctgaaagtccctgggattgaacagaagg 261