Miyakogusa Predicted Gene

Lj0g3v0074119.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0074119.1 Non Chatacterized Hit- tr|I1JGA3|I1JGA3_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,67.92,0,MADS_BOX_2,Transcription factor, MADS-box;
K_BOX,Transcription factor, K-box; MADSDOMAIN,Transcripti,CUFF.3696.1
         (738 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61471 UniRef100_Q533S4 Cluster: MADS box protein PIb;...    52   5e-06
gnl|LJGI|TC57459 UniRef100_Q533R8 Cluster: MADS box protein AGL1...    52   5e-06

>gnl|LJGI|TC61471 UniRef100_Q533S4 Cluster: MADS box protein PIb; n=1; Lotus
           japonicus|Rep: MADS box protein PIb - Lotus japonicus,
           complete
          Length = 841

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 1   atggggaggggtaagattgagataaagaagattgagaa 38
           |||||||| |||||||||||||| |||| |||||||||
Sbjct: 87  atggggagaggtaagattgagatcaagaggattgagaa 124


>gnl|LJGI|TC57459 UniRef100_Q533R8 Cluster: MADS box protein AGL11; n=1; Lotus
           japonicus|Rep: MADS box protein AGL11 - Lotus japonicus,
           complete
          Length = 983

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 1   atggggaggggtaagattgagataaagaagattgagaa 38
           ||||||||||| ||||||||||| |||| |||||||||
Sbjct: 84  atggggagggggaagattgagatcaagaggattgagaa 121