Miyakogusa Predicted Gene

Lj0g3v0073699.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0073699.1 CUFF.3675.1
         (669 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71185 similar to UniRef100_A0KS87 Cluster: Mutator Mu...    82   5e-15

>gnl|LJGI|TC71185 similar to UniRef100_A0KS87 Cluster: Mutator MutT protein; n=1;
           Shewanella sp. ANA-3|Rep: Mutator MutT protein -
           Shewanella sp. (strain ANA-3), partial (10%)
          Length = 559

 Score = 81.8 bits (41), Expect = 5e-15
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                            
Query: 620 ttcgtggtttggaggaggagcttagagagaattggcatgttggcttgta 668
           |||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 291 ttcgtggtttggcggaggagcttagagagaattggcctgttggcttgta 339