Miyakogusa Predicted Gene

Lj0g3v0070859.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0070859.1 Non Chatacterized Hit- tr|H2P705|H2P705_PONAB
Uncharacterized protein OS=Pongo abelii GN=ASAP2 PE=4
,37.29,0.57,seg,NULL,CUFF.3451.1
         (213 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP044719 similar to UniRef100_Q68KY5 Cluster: Optomotor...    84   4e-16

>gnl|LJGI|BP044719 similar to UniRef100_Q68KY5 Cluster: Optomotor blind; n=1;
           Drosophila polymorpha|Rep: Optomotor blind - Drosophila
           polymorpha, partial (9%)
          Length = 477

 Score = 83.8 bits (42), Expect = 4e-16
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 15  ccgccaccatatgctccttccgatctctgcgccgccgccgacaccacccactccatctcc 74
           |||||||||| | |||||||| |||| | |||||||||||||||||||||||||||||||
Sbjct: 248 ccgccaccatcttctccttccaatctatacgccgccgccgacaccacccactccatctcc 307

             
Query: 75  tc 76
           ||
Sbjct: 308 tc 309