Miyakogusa Predicted Gene

Lj0g3v0070459.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0070459.1 CUFF.3414.1
         (487 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58604 similar to UniRef100_P09694 Cluster: Uncharacte...   375   e-103
gnl|LJGI|TC59801                                                       90   1e-17

>gnl|LJGI|TC58604 similar to UniRef100_P09694 Cluster: Uncharacterized protein IRL4;
           n=1; Human herpesvirus 5 strain AD169|Rep:
           Uncharacterized protein IRL4 - Human cytomegalovirus
           (strain AD169) (HHV-5) (Human herpesvirus 5), partial
           (12%)
          Length = 1221

 Score =  375 bits (189), Expect = e-103
 Identities = 240/257 (93%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttcaacgttctctgattcgatggccatggcttctgattctctcatggtgcaagaatcatt 290
           |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 622 ttcatcgttctctgattcgatggtcatggcttctgattctctcatggtgcaagaatcatt 681

                                                                       
Query: 291 cgtgaaggttcaagatgaggattatgccttgcatcctccagttcctttttcatctgcgtg 350
           |||||||||| |||||||||||| || ||||||| ||||||||||| |||| ||||||||
Sbjct: 682 cgtgaaggttgaagatgaggattctgtcttgcatgctccagttcctctttcctctgcgtg 741

                                                                       
Query: 351 ctttgattctgccatagatgaatcgatttctgagaagattcttgatcatttgcctgtttc 410
           |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||
Sbjct: 742 ctttgattctgccatagatgaaacgatttctgagaagattcttgatcattttcctgtttc 801

                                                                       
Query: 411 tttcttcgctgatcgagaaatcaagattccggcgtggaaaccggcgattgaacctttcag 470
           ||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||  
Sbjct: 802 tttcttcgccgatcgagaaatcaagattccggcgtggaaaccggcgattgagccgttcgt 861

                            
Query: 471 tttcggcactttcagca 487
           ||| |||||| ||||||
Sbjct: 862 ttttggcactatcagca 878



 Score =  260 bits (131), Expect = 7e-69
 Identities = 163/173 (94%), Gaps = 3/173 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggtatcagagctccaatggagctcaccgccacttccgtcgccgc---cgtcgccgagt 57
           |||||||||||||||||||||||||||||||| |||||| ||||||   |||||||||||
Sbjct: 428 atggtatcagagctccaatggagctcaccgcctcttccgccgccgctgccgtcgccgagt 487

                                                                       
Query: 58  tacgagcgcttccttcgacctgctcgccgtggcttcaagcgctgccgcggcagcaccact 117
           |||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||
Sbjct: 488 tacgagcgcttcctccgacctgctcgacgtggcttcaagcgctgccgccgcagcaccact 547

                                                                
Query: 118 gcgagattatcttccttcaatttctctgatttgatcgctgattttggagacat 170
           ||||||||||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 548 gcgagattatcttccttcaatttctctgatttggtcactgattttggagacat 600


>gnl|LJGI|TC59801 
          Length = 1003

 Score = 89.7 bits (45), Expect = 1e-17
 Identities = 81/93 (87%), Gaps = 5/93 (5%)
 Strand = Plus / Plus

                                                                       
Query: 395 atcatttgcctgtttctttcttcgctgatcgagaaatcaagattccggcgtggaaaccgg 454
           ||||||| ||||||||||||||||| |||||||||     ||||||||||||||||||||
Sbjct: 31  atcattttcctgtttctttcttcgccgatcgagaa-----gattccggcgtggaaaccgg 85

                                            
Query: 455 cgattgaacctttcagtttcggcactttcagca 487
           ||||||| || |||  ||| |||||||||||||
Sbjct: 86  cgattgatccgttcgtttttggcactttcagca 118