Miyakogusa Predicted Gene
- Lj0g3v0070259.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0070259.1 tr|Q2HTZ8|Q2HTZ8_MEDTR Cytochrome cd1-nitrite
reductase-like, C-terminal haem d1 OS=Medicago truncat,30.67,0.015,
,gene.g5099.t1.1
(675 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL... 56 3e-07
>gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL074Wp; n=1;
Eremothecium gossypii|Rep: ACL074Wp - Ashbya gossypii
(Yeast) (Eremothecium gossypii), partial (8%)
Length = 691
Score = 56.0 bits (28), Expect = 3e-07
Identities = 112/140 (80%)
Strand = Plus / Minus
Query: 11 ctgaagagaagaagttcccagaggctgagatggctttgatagttgatgctttcatctggt 70
||||||||||||| ||| ||||||| |||| || |||| |||||| ||| | ||||
Sbjct: 628 ctgaagagaagaaattctcagaggcagagaaggtgttgacgcgtgatgcgttcttttggt 569
Query: 71 ggcatttctggaaaagaagcaaccagaatgcaaattggtgggattttgtgaaggcattac 130
|| ||| |||||||| | | || |||| ||||| |||||||||||||||| ||||| |
Sbjct: 568 ggtattcctggaaaaaacgaaatcagagggcaaaatggtgggattttgtgatagcattgc 509
Query: 131 tgaagaaattccaaccagaa 150
||| | ||||| ||||||||
Sbjct: 508 tgagggaattcgaaccagaa 489