Miyakogusa Predicted Gene
- Lj0g3v0070239.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0070239.1 Non Chatacterized Hit- tr|O65646|O65646_ARATH
Putative uncharacterized protein AT4g36090
OS=Arabidop,29.57,1e-18,Clavaminate synthase-like,NULL; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL; no description,NULL,CUFF.3397.1
(1353 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC69282 similar to UniRef100_A7PU45 Cluster: Chromosome... 76 6e-13
>gnl|LJGI|TC69282 similar to UniRef100_A7PU45 Cluster: Chromosome chr7 scaffold_31,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr7 scaffold_31, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (10%)
Length = 604
Score = 75.8 bits (38), Expect = 6e-13
Identities = 80/94 (85%)
Strand = Plus / Plus
Query: 1245 gcatctttcaccgcgtgcccagagaggaagggttagggcattgcctcccccagttgaatc 1304
||||||| |||||||||| || | ||||||| || ||||||||| |||| | |||| |
Sbjct: 165 gcatcttccaccgcgtgcacaaaaaggaaggcttctggcattgccctcccccgctgaacc 224
Query: 1305 acacatgggagagtccagttctgaacccagcatt 1338
||||||||||||||| || |||||||||||||||
Sbjct: 225 acacatgggagagtcaagctctgaacccagcatt 258
Score = 61.9 bits (31), Expect = 1e-08
Identities = 46/51 (90%)
Strand = Plus / Plus
Query: 1099 atgatgatgcacgaatggggaatgcttggtgctccaatggtcatgctagcc 1149
|||||||||| | |||||||||||||| | ||||||||||| |||||||||
Sbjct: 16 atgatgatgcccaaatggggaatgcttcgagctccaatggtgatgctagcc 66