Miyakogusa Predicted Gene

Lj0g3v0068309.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0068309.1 Non Chatacterized Hit- tr|I1NDH7|I1NDH7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.55182 PE,78.79,0.00004,
,NODE_23419_length_176_cov_949.818176.path1.1
         (103 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP039237 homologue to UniRef100_A7P0D2 Cluster: Chromos...   204   7e-53
gnl|LJGI|TC66695                                                      204   7e-53

>gnl|LJGI|BP039237 homologue to UniRef100_A7P0D2 Cluster: Chromosome chr6 scaffold_3,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr6 scaffold_3, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (25%)
          Length = 541

 Score =  204 bits (103), Expect = 7e-53
 Identities = 103/103 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgagatcgttggtcactttgttgaaatcaccaaggaccgaatcgagggaatggcagttg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 396 atgagatcgttggtcactttgttgaaatcaccaaggaccgaatcgagggaatggcagttg 337

                                                      
Query: 61  caaatgtccgcacagttgatccccctcaaagatgagtgctaac 103
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 336 caaatgtccgcacagttgatccccctcaaagatgagtgctaac 294


>gnl|LJGI|TC66695 
          Length = 1468

 Score =  204 bits (103), Expect = 7e-53
 Identities = 103/103 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgagatcgttggtcactttgttgaaatcaccaaggaccgaatcgagggaatggcagttg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1001 atgagatcgttggtcactttgttgaaatcaccaaggaccgaatcgagggaatggcagttg 1060

                                                       
Query: 61   caaatgtccgcacagttgatccccctcaaagatgagtgctaac 103
            |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1061 caaatgtccgcacagttgatccccctcaaagatgagtgctaac 1103