Miyakogusa Predicted Gene

Lj0g3v0067539.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0067539.1 tr|G7KNM6|G7KNM6_MEDTR Short-chain alcohol
dehydrogenase OS=Medicago truncatula GN=MTR_6g023590
PE=3,65.41,0,adh_short_C2,NULL; ADH_SHORT,Short-chain
dehydrogenase/reductase, conserved site;
GDHRDH,Glucose/rib,CUFF.3199.1
         (762 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63997 similar to UniRef100_A7QI42 Cluster: Chromosome...   117   1e-25

>gnl|LJGI|TC63997 similar to UniRef100_A7QI42 Cluster: Chromosome chr17 scaffold_101,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr17 scaffold_101, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (86%)
          Length = 1202

 Score =  117 bits (59), Expect = 1e-25
 Identities = 266/335 (79%)
 Strand = Plus / Plus

                                                                       
Query: 235 gacatcatgttcagcaacgccggaatcctcagcccctccgaccagaccgtgacggagctc 294
           ||||||||||||||||||||||| ||||| ||||||||| ||||||||||   ||| |||
Sbjct: 424 gacatcatgttcagcaacgccggcatccttagcccctccaaccagaccgtactggacctc 483

                                                                       
Query: 295 gacatgtcccagctggaccacctattcgcagtcaacgtccgcggcatggcggcgtgcgtc 354
           ||| | ||| ||   |||| |||  | || |  |||   || ||||||||||||||||| 
Sbjct: 484 gacttctccgagtacgaccgccttatggcggcgaacacgcggggcatggcggcgtgcgtg 543

                                                                       
Query: 355 aagcacgcggcgcgtgcgatgatagagcggtgcgtgagggggagcgtggtctgcacgggg 414
           ||||||||||||||||||||| |  || || ||||||| |||||| | || ||| |||  
Sbjct: 544 aagcacgcggcgcgtgcgatggtgaaggggcgcgtgagagggagcatcgtgtgcgcggca 603

                                                                       
Query: 415 agtgtcgcggccacccacgcggggtcgaaggggacggactacacgatgtcgaagcacgcg 474
           || || |||||  | |  | ||   ||| |  |||||| ||| |||||||||||||||||
Sbjct: 604 agcgtggcggcgtcacgaggggctccgacgaagacggattacgcgatgtcgaagcacgcg 663

                                                                       
Query: 475 gtgttggggctggtgcgtgcggcgagtgtgcagcttggggtgcacgggataagggtgaac 534
           ||| |||||||||||||    ||||| ||||||||||||  ||| || || |||||||||
Sbjct: 664 gtgctggggctggtgcgaagtgcgagcgtgcagcttgggaagcatggtattagggtgaac 723

                                              
Query: 535 tgcgtttcaccgaatgggttggcgacgccgttgac 569
           ||||| ||||||| |||| |||  |||||||||||
Sbjct: 724 tgcgtctcaccgagtgggctggtcacgccgttgac 758



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 48  caaagtagccatcataaccggtggggccagcggcatcggggaagcgacggcgcgt 102
           |||||| ||||| || ||||| || |||||||||||||| |||| ||||||||||
Sbjct: 192 caaagttgccataatcaccggcggtgccagcggcatcggcgaagagacggcgcgt 246