Miyakogusa Predicted Gene

Lj0g3v0067139.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0067139.1 tr|Q0QFS0|Q0QFS0_9EUKA DNA-directed RNA
polymerase (Fragment) OS=Paravahlkampfia sp. LA GN=mtRNAP
PE,45.98,3e-19,DNA/RNA polymerases,NULL; DNA-DIRECTED RNA POLYMERASE,
MITOCHONDRIAL,DNA-directed RNA polymerase, ph,CUFF.3170.1
         (264 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71538 similar to UniRef100_Q8L6J3 Cluster: DNA-direct...   194   2e-49
gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-direc...    56   1e-07

>gnl|LJGI|TC71538 similar to UniRef100_Q8L6J3 Cluster: DNA-directed RNA polymerase
           2B, chloroplast/mitochondrial precursor; n=1; Nicotiana
           tabacum|Rep: DNA-directed RNA polymerase 2B,
           chloroplast/mitochondrial precursor - Nicotiana tabacum
           (Common tobacco), partial (3%)
          Length = 730

 Score =  194 bits (98), Expect = 2e-49
 Identities = 98/98 (100%)
 Strand = Plus / Plus

                                                                       
Query: 167 tccagactatgtatccaggattggctttcccttcattgccaaaaactggtgattttgact 226
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tccagactatgtatccaggattggctttcccttcattgccaaaaactggtgattttgact 60

                                                 
Query: 227 tacggaaggttcttgattctccatactttttcaactga 264
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 61  tacggaaggttcttgattctccatactttttcaactga 98


>gnl|LJGI|CB826632 similar to UniRef100_A7PAG7 Cluster: DNA-directed RNA polymerase;
           n=1; Vitis vinifera|Rep: DNA-directed RNA polymerase -
           Vitis vinifera (Grape), partial (13%)
          Length = 520

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 46  gcaggtgttcatgattcattttggacacatgcatgtgatgttga 89
           ||||| ||||||||||||| ||||||||| || |||||||||||
Sbjct: 306 gcaggggttcatgattcatattggacacacgcgtgtgatgttga 349