Miyakogusa Predicted Gene
- Lj0g3v0066379.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0066379.1 Non Chatacterized Hit- tr|K4C9C3|K4C9C3_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,35.29,8e-16,LEA_2,Late embryogenesis abundant protein,
LEA-14,CUFF.3110.1
(363 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC74824 similar to UniRef100_Q01AC1 Cluster: Meltrins, ... 720 0.0
>gnl|LJGI|TC74824 similar to UniRef100_Q01AC1 Cluster: Meltrins, fertilins and
related Zn-dependent metalloproteinases of the ADAMs
family; n=1; Ostreococcus tauri|Rep: Meltrins, fertilins
and related Zn-dependent metalloproteinases of the ADAMs
family - Ostreococcus tauri, partial (5%)
Length = 1278
Score = 720 bits (363), Expect = 0.0
Identities = 363/363 (100%)
Strand = Plus / Plus
Query: 1 atgtccgtcacctacaacggcctccgctcctcgctcttctaccgctccgactacatcacc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 401 atgtccgtcacctacaacggcctccgctcctcgctcttctaccgctccgactacatcacc 460
Query: 61 gagaacaatctcgctccgtttaagcaggataccaagtcacaaaccaccctaaacgccacg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 gagaacaatctcgctccgtttaagcaggataccaagtcacaaaccaccctaaacgccacg 520
Query: 121 ttctccgccgccggcgcctacatcggaacccgcgccgttgattccatcaacgctgaccgg 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 521 ttctccgccgccggcgcctacatcggaacccgcgccgttgattccatcaacgctgaccgg 580
Query: 181 tctggtggctccgtccccttagatgtgcagattctggcatccgcttcgttccgctctggg 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 581 tctggtggctccgtccccttagatgtgcagattctggcatccgcttcgttccgctctggg 640
Query: 241 aagtggaggttcaggacgcgttggcttaaggttctgtgccggaagctccccgtcagcatc 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 641 aagtggaggttcaggacgcgttggcttaaggttctgtgccggaagctccccgtcagcatc 700
Query: 301 aagtcgaactccacttccggcgatttgatcggtggatccagggaatgccaggtgtggact 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 701 aagtcgaactccacttccggcgatttgatcggtggatccagggaatgccaggtgtggact 760
Query: 361 tga 363
|||
Sbjct: 761 tga 763