Miyakogusa Predicted Gene

Lj0g3v0065639.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0065639.1 Non Chatacterized Hit- tr|I1NH81|I1NH81_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,96.38,0,no
description,NULL; seg,NULL; Protein kinase-like (PK-like),Protein
kinase-like domain; PROTEIN_KIN,CUFF.3055.1
         (831 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68377 homologue to UniRef100_Q6BE26 Cluster: Somatic ...   767   0.0  
gnl|LJGI|FS356573 homologue to UniRef100_A7L4A3 Cluster: Somatic...   242   3e-63
gnl|LJGI|TC68728 similar to UniRef100_A7L4A8 Cluster: Somatic em...   222   3e-57
gnl|LJGI|AV410302 similar to UniRef100_Q94F62 Cluster: BRASSINOS...    72   6e-12

>gnl|LJGI|TC68377 homologue to UniRef100_Q6BE26 Cluster: Somatic embryogenesis
           receptor kinase 1; n=1; Citrus unshiu|Rep: Somatic
           embryogenesis receptor kinase 1 - Citrus unshiu (Satsuma
           orange), partial (21%)
          Length = 951

 Score =  767 bits (387), Expect = 0.0
 Identities = 387/387 (100%)
 Strand = Plus / Plus

                                                                       
Query: 445 ctgatcactggacaaagagcgtttgacctagctcggcttgcaaatgatgatgatgttatg 504
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ctgatcactggacaaagagcgtttgacctagctcggcttgcaaatgatgatgatgttatg 60

                                                                       
Query: 505 ttgcttgactgggtaaaaggacttctgaaagagaaaaaactagaaatgctggttgatcct 564
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ttgcttgactgggtaaaaggacttctgaaagagaaaaaactagaaatgctggttgatcct 120

                                                                       
Query: 565 gatctccacaacaattacatagaagctgaggtagaacagttaatccaggttgcactcctt 624
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gatctccacaacaattacatagaagctgaggtagaacagttaatccaggttgcactcctt 180

                                                                       
Query: 625 tgcactcaaggttcccctatggaccggcctaaaatgtcagaggtggtgcgtatgcttgaa 684
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tgcactcaaggttcccctatggaccggcctaaaatgtcagaggtggtgcgtatgcttgaa 240

                                                                       
Query: 685 ggtgatggcttggcagaaagatgggatgagtggcaaaaggtggaaattctccgccaggag 744
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 ggtgatggcttggcagaaagatgggatgagtggcaaaaggtggaaattctccgccaggag 300

                                                                       
Query: 745 atggagctagccccacatcccaattctgattggatagttgactcaactgaaaatcttcat 804
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 atggagctagccccacatcccaattctgattggatagttgactcaactgaaaatcttcat 360

                                      
Query: 805 gcagttgagttatctggtccaaggtaa 831
           |||||||||||||||||||||||||||
Sbjct: 361 gcagttgagttatctggtccaaggtaa 387


>gnl|LJGI|FS356573 homologue to UniRef100_A7L4A3 Cluster: Somatic embryogenesis
           receptor kinase; n=1; Carica papaya|Rep: Somatic
           embryogenesis receptor kinase - Carica papaya (Papaya),
           partial (12%)
          Length = 380

 Score =  242 bits (122), Expect = 3e-63
 Identities = 197/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 608 tccaggttgcactcctttgcactcaaggttcccctatggaccggcctaaaatgtcagagg 667
           ||||||||||||| || ||||| ||||||||||| ||||| || || || ||||| || |
Sbjct: 380 tccaggttgcactgctctgcacacaaggttccccaatggaacgaccaaagatgtcggaag 321

                                                                       
Query: 668 tggtgcgtatgcttgaaggtgatggcttggcagaaagatgggatgagtggcaaaaggtgg 727
           ||||| | |||||||||||||||||||||||||||||||||||||||||||| || ||||
Sbjct: 320 tggtgagaatgcttgaaggtgatggcttggcagaaagatgggatgagtggcagaaagtgg 261

                                                                       
Query: 728 aaattctccgccaggagatggagctagccccacatcccaattctgattggatagttgact 787
           || |||||||||||||   |||||| | ||| ||||||| |||||||||||| |||||||
Sbjct: 260 aagttctccgccaggaatcggagctgggccctcatcccagttctgattggattgttgact 201

                                                     
Query: 788 caactgaaaatcttcatgcagttgagttatctggtccaaggt 829
           ||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 200 caactgaaaatctacatgcagttgaattatctggtccaaggt 159


>gnl|LJGI|TC68728 similar to UniRef100_A7L4A8 Cluster: Somatic embryogenesis receptor
            kinase; n=1; Carica papaya|Rep: Somatic embryogenesis
            receptor kinase - Carica papaya (Papaya), partial (80%)
          Length = 2038

 Score =  222 bits (112), Expect = 3e-57
 Identities = 430/536 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgatcagcatggctgtgcatcgaaatctcctccgtttacgtgggttctgtatgacgccg 60
            ||||||||||||||||||||||| ||||| || ||  | ||||| || || |||||||| 
Sbjct: 782  atgatcagcatggctgtgcatcgtaatctgcttcggcttcgtggcttttgcatgacgcct 841

                                                                        
Query: 61   actgaaaggctccttgtttatccttacatggctaatggaagcgttgcctcatgcttaaga 120
            |||||| || | ||||| ||||||| ||||| ||||||||| || || ||||| ||||||
Sbjct: 842  actgaacggttgcttgtgtatcctttcatggttaatggaagtgtggcatcatgtttaaga 901

                                                                        
Query: 121  gagcgcccagaacatcaaaagccccttgattggccatcaaggaaacagatagctttggga 180
            || || || |||  ||||  ||| ||||| |||||   | || | |  || ||  |||||
Sbjct: 902  gatcgtcctgaaactcaaccgccacttgactggccgatacggcagcgtattgcactggga 961

                                                                        
Query: 181  tcagcgcggggtctttcatatttgcatgagcattgtgacccaaagattattcatcgtgat 240
            || ||  |||| ||||| ||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 962  tctgccaggggactttcttatttgcatgatcattgtgacccgaagattattcatcgtgat 1021

                                                                        
Query: 241  gtgaaagctgcgaacatattgttggatgaggagtttgaggctgttgttggggactttggg 300
            || || ||||| || ||||||||||||||| | ||||| || |||||||| || ||||| 
Sbjct: 1022 gtcaaggctgcaaatatattgttggatgagaaatttgaagcagttgttggagattttggt 1081

                                                                        
Query: 301  ttggccaggctaatggactacaaggacacccatgtgacaactgctgtgcggggcacaatt 360
            ||||| |  || ||||| ||||| || || ||||| || || ||||| || || || |||
Sbjct: 1082 ttggcaaaacttatggattacaaagatactcatgttactaccgctgtacgcggtacgatt 1141

                                                                        
Query: 361  gggcacatagctccagagtacctatctactggtaaatcttcagagaaaacagatgtcttt 420
            ||||| ||||| ||||||||||| || ||||| || ||||| || || || ||||| |||
Sbjct: 1142 gggcatatagcaccagagtacctgtcaactggaaagtcttccgaaaagactgatgttttt 1201

                                                                        
Query: 421  gggtatggtataatgcttctggagctgatcactggacaaagagcgtttgacctagctcgg 480
            || || ||  | |||||||| || || || |||||||| || || || || ||||| || 
Sbjct: 1202 ggatacggagtgatgcttcttgaactaataactggacagagggctttcgatctagcacgt 1261

                                                                    
Query: 481  cttgcaaatgatgatgatgttatgttgcttgactgggtaaaaggacttctgaaaga 536
            ||||| ||||| |||||||| |||||||| || ||||| |||||||||||||||||
Sbjct: 1262 cttgccaatgacgatgatgtgatgttgctcgattgggttaaaggacttctgaaaga 1317


>gnl|LJGI|AV410302 similar to UniRef100_Q94F62 Cluster: BRASSINOSTEROID INSENSITIVE
           1-associated receptor kinase 1 precursor; n=1;
           Arabidopsis thaliana|Rep: BRASSINOSTEROID INSENSITIVE
           1-associated receptor kinase 1 precursor - Arabidopsis
           thaliana (Mouse-ear cress), partial (18%)
          Length = 331

 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 188 ggggtctttcatatttgcatgagcattgtgacccaaagattattcatcgtgatgtgaaag 247
           |||| ||||| |||||||||||  |||||||||| |||||||||||||||||||| || |
Sbjct: 268 ggggactttcttatttgcatgattattgtgacccgaagattattcatcgtgatgtcaagg 327

               
Query: 248 ctgc 251
           ||||
Sbjct: 328 ctgc 331