Miyakogusa Predicted Gene
- Lj0g3v0065639.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0065639.1 Non Chatacterized Hit- tr|I1NH81|I1NH81_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,96.38,0,no
description,NULL; seg,NULL; Protein kinase-like (PK-like),Protein
kinase-like domain; PROTEIN_KIN,CUFF.3055.1
(831 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC68377 homologue to UniRef100_Q6BE26 Cluster: Somatic ... 767 0.0
gnl|LJGI|FS356573 homologue to UniRef100_A7L4A3 Cluster: Somatic... 242 3e-63
gnl|LJGI|TC68728 similar to UniRef100_A7L4A8 Cluster: Somatic em... 222 3e-57
gnl|LJGI|AV410302 similar to UniRef100_Q94F62 Cluster: BRASSINOS... 72 6e-12
>gnl|LJGI|TC68377 homologue to UniRef100_Q6BE26 Cluster: Somatic embryogenesis
receptor kinase 1; n=1; Citrus unshiu|Rep: Somatic
embryogenesis receptor kinase 1 - Citrus unshiu (Satsuma
orange), partial (21%)
Length = 951
Score = 767 bits (387), Expect = 0.0
Identities = 387/387 (100%)
Strand = Plus / Plus
Query: 445 ctgatcactggacaaagagcgtttgacctagctcggcttgcaaatgatgatgatgttatg 504
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 ctgatcactggacaaagagcgtttgacctagctcggcttgcaaatgatgatgatgttatg 60
Query: 505 ttgcttgactgggtaaaaggacttctgaaagagaaaaaactagaaatgctggttgatcct 564
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 ttgcttgactgggtaaaaggacttctgaaagagaaaaaactagaaatgctggttgatcct 120
Query: 565 gatctccacaacaattacatagaagctgaggtagaacagttaatccaggttgcactcctt 624
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gatctccacaacaattacatagaagctgaggtagaacagttaatccaggttgcactcctt 180
Query: 625 tgcactcaaggttcccctatggaccggcctaaaatgtcagaggtggtgcgtatgcttgaa 684
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tgcactcaaggttcccctatggaccggcctaaaatgtcagaggtggtgcgtatgcttgaa 240
Query: 685 ggtgatggcttggcagaaagatgggatgagtggcaaaaggtggaaattctccgccaggag 744
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 ggtgatggcttggcagaaagatgggatgagtggcaaaaggtggaaattctccgccaggag 300
Query: 745 atggagctagccccacatcccaattctgattggatagttgactcaactgaaaatcttcat 804
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 atggagctagccccacatcccaattctgattggatagttgactcaactgaaaatcttcat 360
Query: 805 gcagttgagttatctggtccaaggtaa 831
|||||||||||||||||||||||||||
Sbjct: 361 gcagttgagttatctggtccaaggtaa 387
>gnl|LJGI|FS356573 homologue to UniRef100_A7L4A3 Cluster: Somatic embryogenesis
receptor kinase; n=1; Carica papaya|Rep: Somatic
embryogenesis receptor kinase - Carica papaya (Papaya),
partial (12%)
Length = 380
Score = 242 bits (122), Expect = 3e-63
Identities = 197/222 (88%)
Strand = Plus / Minus
Query: 608 tccaggttgcactcctttgcactcaaggttcccctatggaccggcctaaaatgtcagagg 667
||||||||||||| || ||||| ||||||||||| ||||| || || || ||||| || |
Sbjct: 380 tccaggttgcactgctctgcacacaaggttccccaatggaacgaccaaagatgtcggaag 321
Query: 668 tggtgcgtatgcttgaaggtgatggcttggcagaaagatgggatgagtggcaaaaggtgg 727
||||| | |||||||||||||||||||||||||||||||||||||||||||| || ||||
Sbjct: 320 tggtgagaatgcttgaaggtgatggcttggcagaaagatgggatgagtggcagaaagtgg 261
Query: 728 aaattctccgccaggagatggagctagccccacatcccaattctgattggatagttgact 787
|| ||||||||||||| |||||| | ||| ||||||| |||||||||||| |||||||
Sbjct: 260 aagttctccgccaggaatcggagctgggccctcatcccagttctgattggattgttgact 201
Query: 788 caactgaaaatcttcatgcagttgagttatctggtccaaggt 829
||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 200 caactgaaaatctacatgcagttgaattatctggtccaaggt 159
>gnl|LJGI|TC68728 similar to UniRef100_A7L4A8 Cluster: Somatic embryogenesis receptor
kinase; n=1; Carica papaya|Rep: Somatic embryogenesis
receptor kinase - Carica papaya (Papaya), partial (80%)
Length = 2038
Score = 222 bits (112), Expect = 3e-57
Identities = 430/536 (80%)
Strand = Plus / Plus
Query: 1 atgatcagcatggctgtgcatcgaaatctcctccgtttacgtgggttctgtatgacgccg 60
||||||||||||||||||||||| ||||| || || | ||||| || || ||||||||
Sbjct: 782 atgatcagcatggctgtgcatcgtaatctgcttcggcttcgtggcttttgcatgacgcct 841
Query: 61 actgaaaggctccttgtttatccttacatggctaatggaagcgttgcctcatgcttaaga 120
|||||| || | ||||| ||||||| ||||| ||||||||| || || ||||| ||||||
Sbjct: 842 actgaacggttgcttgtgtatcctttcatggttaatggaagtgtggcatcatgtttaaga 901
Query: 121 gagcgcccagaacatcaaaagccccttgattggccatcaaggaaacagatagctttggga 180
|| || || ||| |||| ||| ||||| ||||| | || | | || || |||||
Sbjct: 902 gatcgtcctgaaactcaaccgccacttgactggccgatacggcagcgtattgcactggga 961
Query: 181 tcagcgcggggtctttcatatttgcatgagcattgtgacccaaagattattcatcgtgat 240
|| || |||| ||||| ||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 962 tctgccaggggactttcttatttgcatgatcattgtgacccgaagattattcatcgtgat 1021
Query: 241 gtgaaagctgcgaacatattgttggatgaggagtttgaggctgttgttggggactttggg 300
|| || ||||| || ||||||||||||||| | ||||| || |||||||| || |||||
Sbjct: 1022 gtcaaggctgcaaatatattgttggatgagaaatttgaagcagttgttggagattttggt 1081
Query: 301 ttggccaggctaatggactacaaggacacccatgtgacaactgctgtgcggggcacaatt 360
||||| | || ||||| ||||| || || ||||| || || ||||| || || || |||
Sbjct: 1082 ttggcaaaacttatggattacaaagatactcatgttactaccgctgtacgcggtacgatt 1141
Query: 361 gggcacatagctccagagtacctatctactggtaaatcttcagagaaaacagatgtcttt 420
||||| ||||| ||||||||||| || ||||| || ||||| || || || ||||| |||
Sbjct: 1142 gggcatatagcaccagagtacctgtcaactggaaagtcttccgaaaagactgatgttttt 1201
Query: 421 gggtatggtataatgcttctggagctgatcactggacaaagagcgtttgacctagctcgg 480
|| || || | |||||||| || || || |||||||| || || || || ||||| ||
Sbjct: 1202 ggatacggagtgatgcttcttgaactaataactggacagagggctttcgatctagcacgt 1261
Query: 481 cttgcaaatgatgatgatgttatgttgcttgactgggtaaaaggacttctgaaaga 536
||||| ||||| |||||||| |||||||| || ||||| |||||||||||||||||
Sbjct: 1262 cttgccaatgacgatgatgtgatgttgctcgattgggttaaaggacttctgaaaga 1317
>gnl|LJGI|AV410302 similar to UniRef100_Q94F62 Cluster: BRASSINOSTEROID INSENSITIVE
1-associated receptor kinase 1 precursor; n=1;
Arabidopsis thaliana|Rep: BRASSINOSTEROID INSENSITIVE
1-associated receptor kinase 1 precursor - Arabidopsis
thaliana (Mouse-ear cress), partial (18%)
Length = 331
Score = 71.9 bits (36), Expect = 6e-12
Identities = 57/64 (89%)
Strand = Plus / Plus
Query: 188 ggggtctttcatatttgcatgagcattgtgacccaaagattattcatcgtgatgtgaaag 247
|||| ||||| ||||||||||| |||||||||| |||||||||||||||||||| || |
Sbjct: 268 ggggactttcttatttgcatgattattgtgacccgaagattattcatcgtgatgtcaagg 327
Query: 248 ctgc 251
||||
Sbjct: 328 ctgc 331