Miyakogusa Predicted Gene

Lj0g3v0065579.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0065579.2 Non Chatacterized Hit- tr|B9RGV9|B9RGV9_RICCO
Cystathionine beta-lyase, putative OS=Ricinus
communis,63.16,0.001,seg,NULL,CUFF.3050.2
         (303 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59348 similar to UniRef100_A7QJK0 Cluster: Chromosome...   135   2e-31
gnl|LJGI|TC82449 homologue to UniRef100_A7P2D0 Cluster: Chromoso...    52   2e-06

>gnl|LJGI|TC59348 similar to UniRef100_A7QJK0 Cluster: Chromosome chr8 scaffold_106,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_106, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (97%)
          Length = 1757

 Score =  135 bits (68), Expect = 2e-31
 Identities = 101/112 (90%)
 Strand = Plus / Plus

                                                                       
Query: 97  aattcggcgaatttcagaacaagtgaactgttgtgtgcgaaagggttcaagctttattgc 156
           ||||| |||||||||||||||||||||||||||| |||||||||||||||| |  | |||
Sbjct: 202 aattccgcgaatttcagaacaagtgaactgttgtctgcgaaagggttcaagttgaactgc 261

                                                               
Query: 157 tcacttgatagagaaatggatgtgagcacttcgcctatggtggattatgctg 208
           ||| ||||||||||||||||||| ||||||||| || |||||||| ||||||
Sbjct: 262 tcagttgatagagaaatggatgtcagcacttcggctgtggtggatgatgctg 313



 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 57  aacaattgttccttctccgatctctctcaggcccttcgcaaattc 101
           |||||| ||||||||| |||||||||||||  ||||| |||||||
Sbjct: 87  aacaatggttccttcttcgatctctctcagaaccttcacaaattc 131


>gnl|LJGI|TC82449 homologue to UniRef100_A7P2D0 Cluster: Chromosome chr1 scaffold_5,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr1 scaffold_5, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (8%)
          Length = 1122

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 248 tgctactgttgcagaggagaaacactcagc 277
           ||||||||||||| ||||||||||||||||
Sbjct: 662 tgctactgttgcaaaggagaaacactcagc 691