Miyakogusa Predicted Gene

Lj0g3v0065209.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0065209.1 Non Chatacterized Hit- tr|I3T4F8|I3T4F8_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,99.3,0,Aquaporin-like,Aquaporin-like; MINTRINSICP,Major intrinsic
protein; MIP,Major intrinsic protein, con,CUFF.3095.1
         (867 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72638 homologue to UniRef100_O65357 Cluster: Aquapori...  1719   0.0  
gnl|LJGI|BW598844 homologue to UniRef100_O65357 Cluster: Aquapor...   517   e-146
gnl|LJGI|TC79489 similar to UniRef100_Q5DVT9 Cluster: Plasma mem...   230   1e-59
gnl|LJGI|TC65853 homologue to UniRef100_Q9ATM4 Cluster: Aquapori...   224   7e-58
gnl|LJGI|TC71830 homologue to UniRef100_Q2HV44 Cluster: Major in...   214   7e-55
gnl|LJGI|TC78096 homologue to UniRef100_Q8W1A8 Cluster: Aquapori...   186   2e-46
gnl|LJGI|TC67926 homologue to UniRef100_Q06Z30 Cluster: Aquapori...   153   2e-36
gnl|LJGI|TC80996 similar to UniRef100_Q06Z30 Cluster: Aquaporin ...   143   2e-33
gnl|LJGI|BI420390 homologue to UniRef100_Q5U7L0 Cluster: Plasma ...   119   3e-26
gnl|LJGI|TC67210 homologue to UniRef100_O22339 Cluster: Aquapori...   119   3e-26
gnl|LJGI|TC71350 similar to UniRef100_A3F570 Cluster: Aquaporin;...   107   1e-22
gnl|LJGI|TC67613 homologue to UniRef100_Q5DVT5 Cluster: Plasma m...   107   1e-22
gnl|LJGI|TC80088 homologue to UniRef100_Q946J9 Cluster: Aquapori...    96   4e-19
gnl|LJGI|DN652353 UniRef100_A3F571 Cluster: Aquaporin; n=1; Cucu...    84   2e-15
gnl|LJGI|TC81950 homologue to UniRef100_Q2TFP3 Cluster: PIP2,2; ...    70   3e-11
gnl|LJGI|TC74931 homologue to UniRef100_A0T2N6 Cluster: PIP1 pro...    56   4e-07
gnl|LJGI|BP036983 homologue to UniRef100_Q5DVT6 Cluster: Plasma ...    54   1e-06
gnl|LJGI|AV774659 similar to UniRef100_A0T2N6 Cluster: PIP1 prot...    54   1e-06
gnl|LJGI|NP459447 GB|AF145708.1|AAD35016.1 plasma membrane intri...    54   1e-06
gnl|LJGI|TC79198 similar to UniRef100_Q5DVT5 Cluster: Plasma mem...    52   6e-06

>gnl|LJGI|TC72638 homologue to UniRef100_O65357 Cluster: Aquaporin 2; n=1; Samanea
           saman|Rep: Aquaporin 2 - Samanea saman (Rain tree),
           complete
          Length = 1276

 Score = 1719 bits (867), Expect = 0.0
 Identities = 867/867 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccaaggacgttgaggttgctgagcgtggctctttctctagcaaggactaccatgac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 104 atggccaaggacgttgaggttgctgagcgtggctctttctctagcaaggactaccatgac 163

                                                                       
Query: 61  cctcctcctgcacctctcattgatgcagaggagctcacaaagtggtccttctacagggca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 164 cctcctcctgcacctctcattgatgcagaggagctcacaaagtggtccttctacagggca 223

                                                                       
Query: 121 gtcattgctgagttcattgccactttgcttttcctttacattactgtgctcactgtgatt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 224 gtcattgctgagttcattgccactttgcttttcctttacattactgtgctcactgtgatt 283

                                                                       
Query: 181 ggctacaaggttcagagtgatgtcaaaaatggtggagatgattgtggaggtgttggcatt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 ggctacaaggttcagagtgatgtcaaaaatggtggagatgattgtggaggtgttggcatt 343

                                                                       
Query: 241 cttggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctggg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 344 cttggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctggg 403

                                                                       
Query: 301 atctcagggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtg 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 404 atctcagggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtg 463

                                                                       
Query: 361 tctttgatccgagccatcttgtacatggtggctcagtgcttgggagctatttgtggagtt 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 464 tctttgatccgagccatcttgtacatggtggctcagtgcttgggagctatttgtggagtt 523

                                                                       
Query: 421 gggttggttaaggctttccagaagtctcactacaacaaatatggtggtggagctaactct 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 524 gggttggttaaggctttccagaagtctcactacaacaaatatggtggtggagctaactct 583

                                                                       
Query: 481 cttaatgatgggtacagcacaggtactggattaggtgctgagatcattggtacctttgtt 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cttaatgatgggtacagcacaggtactggattaggtgctgagatcattggtacctttgtt 643

                                                                       
Query: 541 ttggtatacacagtgttctctgctactgatcccaaaagaagtgccagagattcccatgtg 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 644 ttggtatacacagtgttctctgctactgatcccaaaagaagtgccagagattcccatgtg 703

                                                                       
Query: 601 ccggttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatc 660
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 704 ccggttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatc 763

                                                                       
Query: 661 ccagtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 764 ccagtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 823

                                                                       
Query: 721 caatctaaaccctgggatgaccattggatcttctgggtaggaccattcattggggcagcc 780
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 824 caatctaaaccctgggatgaccattggatcttctgggtaggaccattcattggggcagcc 883

                                                                       
Query: 781 attgcagcattctaccaccagttcatcttgagagcaggtgcagtgaaggctcttggatca 840
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 884 attgcagcattctaccaccagttcatcttgagagcaggtgcagtgaaggctcttggatca 943

                                      
Query: 841 ttcaggagtaaccccactgtttaagtt 867
           |||||||||||||||||||||||||||
Sbjct: 944 ttcaggagtaaccccactgtttaagtt 970


>gnl|LJGI|BW598844 homologue to UniRef100_O65357 Cluster: Aquaporin 2; n=1; Samanea
           saman|Rep: Aquaporin 2 - Samanea saman (Rain tree),
           partial (31%)
          Length = 479

 Score =  517 bits (261), Expect = e-146
 Identities = 264/265 (99%)
 Strand = Plus / Plus

                                                                       
Query: 603 ggttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatccc 662
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 78  ggttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatccc 137

                                                                       
Query: 663 agtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaacca 722
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 138 agtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaacca 197

                                                                       
Query: 723 atctaaaccctgggatgaccattggatcttctgggtaggaccattcattggggcagccat 782
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198 atctaagccctgggatgaccattggatcttctgggtaggaccattcattggggcagccat 257

                                                                       
Query: 783 tgcagcattctaccaccagttcatcttgagagcaggtgcagtgaaggctcttggatcatt 842
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 258 tgcagcattctaccaccagttcatcttgagagcaggtgcagtgaaggctcttggatcatt 317

                                    
Query: 843 caggagtaaccccactgtttaagtt 867
           |||||||||||||||||||||||||
Sbjct: 318 caggagtaaccccactgtttaagtt 342


>gnl|LJGI|TC79489 similar to UniRef100_Q5DVT9 Cluster: Plasma membrane intrinsic
           protein 2;1; n=1; Mimosa pudica|Rep: Plasma membrane
           intrinsic protein 2;1 - Mimosa pudica (Sensitive plant),
           partial (95%)
          Length = 1169

 Score =  230 bits (116), Expect = 1e-59
 Identities = 224/260 (86%)
 Strand = Plus / Plus

                                                                       
Query: 514 ggtgctgagatcattggtacctttgttttggtatacacagtgttctctgctactgatccc 573
           ||||||||||| ||||| ||||| ||| | || ||||| || |||||||| |||||||| 
Sbjct: 555 ggtgctgagattattggcaccttcgttcttgtctacactgttttctctgccactgatcct 614

                                                                       
Query: 574 aaaagaagtgccagagattcccatgtgccggttttggctccacttcccattggatttgct 633
           || ||||  || || ||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 615 aagagaaacgctagggattcccatgttcctgttttggctccacttcctattggatttgct 674

                                                                       
Query: 634 gtgttcatggttcacttggccaccatcccagtcactggtactggcattaaccctgctagg 693
           |||||||||||||||||||| || ||||| || ||||||||||| |||||||| || |||
Sbjct: 675 gtgttcatggttcacttggctacaatccctgttactggtactggaattaacccagcaagg 734

                                                                       
Query: 694 agttttggagctgctgttatcttcaaccaatctaaaccctgggatgaccattggatcttc 753
           ||||||||||||||||| |||| |||| ||   |||  |||||||||||||||||| |||
Sbjct: 735 agttttggagctgctgtcatctacaacgaagacaaaatctgggatgaccattggattttc 794

                               
Query: 754 tgggtaggaccattcattgg 773
           ||||| |||||||| |||||
Sbjct: 795 tgggttggaccatttattgg 814



 Score =  153 bits (77), Expect = 2e-36
 Identities = 113/125 (90%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatc 303
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 286 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgccggtatc 345

                                                                       
Query: 304 tcagggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtgtct 363
           || || || ||||| ||||| ||||||||||||||||||||| | |  || |||||||||
Sbjct: 346 tctggaggacacataaaccctgcagtgacatttgggctgttcataggacgcaaggtgtct 405

                
Query: 364 ttgat 368
           |||||
Sbjct: 406 ttgat 410



 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 88  gaggagctcacaaagtggtccttctacagggcagtcattgctgagttcattgccac 143
           |||||||| |||||||||||||||||||| ||  |||| ||||||||||| |||||
Sbjct: 142 gaggagctgacaaagtggtccttctacagagctctcatagctgagttcatagccac 197


>gnl|LJGI|TC65853 homologue to UniRef100_Q9ATM4 Cluster: Aquaporin PIP2-7; n=1; Zea
           mays|Rep: Aquaporin PIP2-7 - Zea mays (Maize), complete
          Length = 1346

 Score =  224 bits (113), Expect = 7e-58
 Identities = 386/477 (80%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatc 303
           ||||| ||||||||||||||||||||||||||| ||||||||||||||||||| || |||
Sbjct: 418 ggtatagcttgggcctttggtggcatgatcttcgtccttgtttactgcaccgccggtatc 477

                                                                       
Query: 304 tcagggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtgtct 363
           ||||| || || |||||||| || |||||||||||||| ||| |||  || |||||||| 
Sbjct: 478 tcaggagggcatattaaccctgctgtgacatttgggctattcgtgggacgcaaggtgtcc 537

                                                                       
Query: 364 ttgatccgagccatcttgtacatggtggctcagtgcttgggagctatttgtggagttggg 423
            || |  | ||  |  |||||||  | || |||||||| || || || ||||| | ||| 
Sbjct: 538 ctggtaagggcgttactgtacatcattgcacagtgcttaggtgcaatctgtggtgctgga 597

                                                                       
Query: 424 ttggttaaggctttccagaagtctcactacaacaaatatggtggtggagctaactctctt 483
            | | |||||  ||||| || ||   |||||||| |||||| ||||| |||||| |  | 
Sbjct: 598 cttgctaagggcttccaaaaatcattctacaacagatatggaggtggggctaacacaatc 657

                                                                       
Query: 484 aatgatgggtacagcacaggtactggattaggtgctgagatcattggtacctttgttttg 543
              ||||| ||||||| ||| || |  || |||||||||||||| || ||||||||| | 
Sbjct: 658 tcagatggctacagcaaaggcacagctttgggtgctgagatcataggaacctttgttctt 717

                                                                       
Query: 544 gtatacacagtgttctctgctactgatcccaaaagaagtgccagagattcccatgtgccg 603
           || ||||| || ||||||||||||||||| || || |  || || ||||||||||| || 
Sbjct: 718 gtctacactgttttctctgctactgatcctaagaggaacgctagggattcccatgttcct 777

                                                                       
Query: 604 gttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatccca 663
           ||  |||| |||||||| |||||||||||||||||||||||||||||||| || ||||| 
Sbjct: 778 gtactggcaccacttccaattggatttgctgtgttcatggttcacttggctacaatccct 837

                                                                    
Query: 664 gtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
           || ||||| |||||||||||||| || |||||||||||| | |||||||||||||||
Sbjct: 838 gttactggcactggcattaacccagcaaggagttttggaccagctgttatcttcaac 894


>gnl|LJGI|TC71830 homologue to UniRef100_Q2HV44 Cluster: Major intrinsic protein;
           n=1; Medicago truncatula|Rep: Major intrinsic protein -
           Medicago truncatula (Barrel medic), partial (97%)
          Length = 1178

 Score =  214 bits (108), Expect = 7e-55
 Identities = 465/584 (79%)
 Strand = Plus / Plus

                                                                       
Query: 232 gttggcattcttggtattgcttgggcctttggtggcatgatcttcatccttgtttactgc 291
           |||||||| || || || ||||||||||| || |||||||| |||||||| |||||||||
Sbjct: 300 gttggcatcctcggcatcgcttgggccttcggcggcatgattttcatcctcgtttactgc 359

                                                                       
Query: 292 accgctgggatctcagggggtcacattaacccagcagtgacatttgggctgttcttggct 351
           ||||| || ||||||||||||||||| ||||| || ||||| || ||  ||||| |||| 
Sbjct: 360 accgccggcatctcagggggtcacataaacccggcggtgacgttcggtttgttcctggcg 419

                                                                       
Query: 352 cgtaaggtgtctttgatccgagccatcttgtacatggtggctcagtgcttgggagctatt 411
            | ||||| ||  || || ||||  | || ||||||||||||||||| |||||||| || 
Sbjct: 420 aggaaggtttcactggtcagagctttgttctacatggtggctcagtgtttgggagccata 479

                                                                       
Query: 412 tgtggagttgggttggttaaggctttccagaagtctcactacaacaaatatggtggtgga 471
            | || ||||||||||| |||||||| |||||     |||||||||  ||   ||| || 
Sbjct: 480 agcggtgttgggttggtgaaggcttttcagaaaagctactacaacaggtaccatggcggt 539

                                                                       
Query: 472 gctaactctcttaatgatgggtacagcacaggtactggattaggtgctgagatcattggt 531
           || |||   |||  |||||| |||  ||  || ||||| || || |||||||| || || 
Sbjct: 540 gcaaacatgcttgctgatggctactccaagggaactggtttgggcgctgagattatcggc 599

                                                                       
Query: 532 acctttgttttggtatacacagtgttctctgctactgatcccaaaagaagtgccagagat 591
           ||||||||  | || ||||| || ||||| || || |||||||| ||||  |||||||||
Sbjct: 600 acctttgtccttgtctacaccgtcttctccgccaccgatcccaagagaaacgccagagat 659

                                                                       
Query: 592 tcccatgtgccggttttggctccacttcccattggatttgctgtgttcatggttcacttg 651
           |||||||| || |||||||| || ||||| ||||| ||||| ||||||||||||||||||
Sbjct: 660 tcccatgttcctgttttggcacctcttccaattgggtttgcagtgttcatggttcacttg 719

                                                                       
Query: 652 gccaccatcccagtcactggtactggcattaaccctgctaggagttttggagctgctgtt 711
           |||||||||||  ||||||| || || || ||||||||||| || || ||||||||||| 
Sbjct: 720 gccaccatccccatcactggaaccggaatcaaccctgctagaagcttcggagctgctgtc 779

                                                                       
Query: 712 atcttcaaccaatctaaaccctgggatgaccattggatcttctgggtaggaccattcatt 771
           || | |||| |    ||  | ||||||||||| |||||||||||||| ||||| ||||||
Sbjct: 780 atatacaacaacgagaaggcatgggatgaccagtggatcttctgggtgggacctttcatt 839

                                                       
Query: 772 ggggcagccattgcagcattctaccaccagttcatcttgagagc 815
           || ||  | ||||| ||| |||||||||||| | | ||||||||
Sbjct: 840 ggtgctactattgctgcaatctaccaccagtacgtgttgagagc 883


>gnl|LJGI|TC78096 homologue to UniRef100_Q8W1A8 Cluster: Aquaporin-like protein; n=1;
           Petunia x hybrida|Rep: Aquaporin-like protein - Petunia
           hybrida (Petunia), partial (30%)
          Length = 800

 Score =  186 bits (94), Expect = 2e-46
 Identities = 151/170 (88%)
 Strand = Plus / Plus

                                                                       
Query: 604 gttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatccca 663
           ||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| 
Sbjct: 5   gttttggctccacttcctattggatttgctgtgttcatggttcacttggctacaatccct 64

                                                                       
Query: 664 gtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaaccaa 723
           || ||||||||||| |||||||| || |||||||||||||||||||| |||| |||| ||
Sbjct: 65  gttactggtactggaattaacccagcaaggagttttggagctgctgtcatctacaacgaa 124

                                                             
Query: 724 tctaaaccctgggatgaccattggatcttctgggtaggaccattcattgg 773
              |||  |||||||||||||||||| |||||||| |||||||| |||||
Sbjct: 125 gacaaaatctgggatgaccattggattttctgggttggaccatttattgg 174


>gnl|LJGI|TC67926 homologue to UniRef100_Q06Z30 Cluster: Aquaporin 1; n=1; Gossypium
           hirsutum|Rep: Aquaporin 1 - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (98%)
          Length = 1615

 Score =  153 bits (77), Expect = 2e-36
 Identities = 203/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 529 ggtacctttgttttggtatacacagtgttctctgctactgatcccaaaagaagtgccaga 588
           |||||||||||| | || ||||| || |||||||| |||||| |||| |||| |||||||
Sbjct: 695 ggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaatgccaga 754

                                                                       
Query: 589 gattcccatgtgccggttttggctccacttcccattggatttgctgtgttcatggttcac 648
           || || ||||| ||| ||||||| || |||||||||||||||||||||||| |||| |||
Sbjct: 755 gactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttggtccac 814

                                                                       
Query: 649 ttggccaccatcccagtcactggtactggcattaaccctgctaggagttttggagctgct 708
           ||||| ||||| ||  |||| || |||||||||||||| ||||||||| |||| ||||| 
Sbjct: 815 ttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggtgctgcc 874

                                                                       
Query: 709 gttatcttcaaccaatctaaaccctgggatgaccattggatcttctgggtaggaccattc 768
            |||| | ||||  |    |  | ||||||||||||||||| |||||||| ||||| |||
Sbjct: 875 attatatacaacagagaccatgcttgggatgaccattggattttctgggttggacctttc 934

                
Query: 769 attgg 773
           |||||
Sbjct: 935 attgg 939



 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 100/120 (83%)
 Strand = Plus / Plus

                                                                       
Query: 231 tgttggcattcttggtattgcttgggcctttggtggcatgatcttcatccttgtttactg 290
           ||||||||| |  |||||||||||||| |||||||||||||||||   |||||| |||||
Sbjct: 394 tgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctactg 453

                                                                       
Query: 291 caccgctgggatctcagggggtcacattaacccagcagtgacatttgggctgttcttggc 350
           ||| ||||| || ||||| || |||||||| || || ||||| || || ||||| |||||
Sbjct: 454 cacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttggc 513


>gnl|LJGI|TC80996 similar to UniRef100_Q06Z30 Cluster: Aquaporin 1; n=1; Gossypium
           hirsutum|Rep: Aquaporin 1 - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), complete
          Length = 1192

 Score =  143 bits (72), Expect = 2e-33
 Identities = 171/204 (83%)
 Strand = Plus / Plus

                                                                       
Query: 517 gctgagatcattggtacctttgttttggtatacacagtgttctctgctactgatcccaaa 576
           ||||||||  |||| ||||||||| | || ||||| || |||||||| |||||| |||| 
Sbjct: 604 gctgagattgttggcacctttgttcttgtctacaccgttttctctgccactgatgccaag 663

                                                                       
Query: 577 agaagtgccagagattcccatgtgccggttttggctccacttcccattggatttgctgtg 636
           ||||  || ||||| || ||||| ||  |||||||||| ||||||||||| |||||||||
Sbjct: 664 agaaacgctagagactctcatgttcctattttggctccccttcccattgggtttgctgtg 723

                                                                       
Query: 637 ttcatggttcacttggccaccatcccagtcactggtactggcattaaccctgctaggagt 696
           ||| |||| |||||||||||||| ||  |||| || ||||| |||||||| |||||||||
Sbjct: 724 ttcttggtccacttggccaccattcccatcacaggaactggaattaacccagctaggagt 783

                                   
Query: 697 tttggagctgctgttatcttcaac 720
            ||||||||||| | |||||||||
Sbjct: 784 cttggagctgctttaatcttcaac 807



 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 91/108 (84%)
 Strand = Plus / Plus

                                                                       
Query: 231 tgttggcattcttggtattgcttgggcctttggtggcatgatcttcatccttgtttactg 290
           |||||||||||  || ||||||||| | |||||||||||||||||   |||||| |||||
Sbjct: 315 tgttggcattcagggcattgcttggtcttttggtggcatgatctttgcccttgtctactg 374

                                                           
Query: 291 caccgctgggatctcagggggtcacattaacccagcagtgacatttgg 338
           ||| ||||| || ||||| || ||||| |||||||| ||||| |||||
Sbjct: 375 cactgctggaatttcaggtggacacataaacccagctgtgacctttgg 422


>gnl|LJGI|BI420390 homologue to UniRef100_Q5U7L0 Cluster: Plasma membrane intrinsic
           protein; n=1; Glycyrrhiza uralensis|Rep: Plasma membrane
           intrinsic protein - Glycyrrhiza uralensis, partial (51%)
          Length = 493

 Score =  119 bits (60), Expect = 3e-26
 Identities = 93/104 (89%)
 Strand = Plus / Plus

                                                                       
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
           ||||||||||| ||||||||||||||||||   || ||||||||||| ||||| ||||| 
Sbjct: 316 attgcttgggcttttggtggcatgatcttcgcactcgtttactgcactgctggaatctct 375

                                                       
Query: 307 gggggtcacattaacccagcagtgacatttgggctgttcttggc 350
           ||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 376 gggggtcacataaacccagcggtgacatttggtctgttcttggc 419


>gnl|LJGI|TC67210 homologue to UniRef100_O22339 Cluster: Aquaporin-like transmembrane
           channel protein; n=1; Medicago sativa|Rep:
           Aquaporin-like transmembrane channel protein - Medicago
           sativa (Alfalfa), complete
          Length = 1162

 Score =  119 bits (60), Expect = 3e-26
 Identities = 93/104 (89%)
 Strand = Plus / Plus

                                                                       
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
           ||||||||||| ||||||||||||||||||   || ||||||||||| ||||| ||||| 
Sbjct: 333 attgcttgggcttttggtggcatgatcttcgcactcgtttactgcactgctggaatctct 392

                                                       
Query: 307 gggggtcacattaacccagcagtgacatttgggctgttcttggc 350
           ||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 393 gggggtcacataaacccagcggtgacatttggtctgttcttggc 436



 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                       
Query: 732 ctgggatgaccattggatcttctgggtaggaccattcattggggcagccattgcagcatt 791
           |||||||||||| ||||| |||||||| ||||| |||||||| |||||  |||| ||| |
Sbjct: 822 ctgggatgaccactggattttctgggttggacctttcattggagcagctcttgcggcact 881

                    
Query: 792 ctaccacca 800
            ||||||||
Sbjct: 882 ttaccacca 890


>gnl|LJGI|TC71350 similar to UniRef100_A3F570 Cluster: Aquaporin; n=1; Cucumis
           sativus|Rep: Aquaporin - Cucumis sativus (Cucumber),
           partial (97%)
          Length = 1168

 Score =  107 bits (54), Expect = 1e-22
 Identities = 102/118 (86%)
 Strand = Plus / Plus

                                                                       
Query: 250 gcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctcaggg 309
           |||||| | |||||||| ||||||||    ||||| || ||||| ||||| |||||||||
Sbjct: 359 gcttggtcatttggtggaatgatctttgctcttgtctattgcactgctggcatctcaggg 418

                                                                     
Query: 310 ggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtgtctttga 367
           |||||||| |||||||||||||||||||||||||||||||| || ||| | |||||||
Sbjct: 419 ggtcacataaacccagcagtgacatttgggctgttcttggcacgcaagctatctttga 476



 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 733 tgggatgaccattggatcttctgggtaggaccattcattggggcagccattgcagc 788
           ||||||||||||||||| || |||||||| |||||||||||||||||  |||||||
Sbjct: 842 tgggatgaccattggatattttgggtagggccattcattggggcagcacttgcagc 897


>gnl|LJGI|TC67613 homologue to UniRef100_Q5DVT5 Cluster: Plasma membrane intrinsic
           protein 2;5; n=1; Mimosa pudica|Rep: Plasma membrane
           intrinsic protein 2;5 - Mimosa pudica (Sensitive plant),
           partial (95%)
          Length = 1075

 Score =  107 bits (54), Expect = 1e-22
 Identities = 369/474 (77%)
 Strand = Plus / Plus

                                                                       
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
           ||||| ||| |||| || |||||||||||| |||| || ||||||||||| || ||||| 
Sbjct: 236 attgcctggtccttcggcggcatgatcttcgtcctcgtctactgcaccgccggcatctcc 295

                                                                       
Query: 307 gggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtgtctttg 366
           || || ||||| ||||| || || || || || || ||| | ||||| ||||||||| | 
Sbjct: 296 ggcggccacatcaaccccgccgtcaccttcggcctcttcctcgctcgcaaggtgtctctc 355

                                                                       
Query: 367 atccgagccatcttgtacatggtggctcagtgcttgggagctatttgtggagttgggttg 426
           || |||||  ||||||||||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 356 attcgagctgtcttgtacatggtagctcagtgcttgggtgctatctgcggtgttgggttg 415

                                                                       
Query: 427 gttaaggctttccagaagtctcactacaacaaatatggtggtggagctaactctcttaat 486
           || ||||| |||  ||||   | |||||||      || || || ||||||||  |   |
Sbjct: 416 gtgaaggcgttcatgaagcacccctacaactccctcggcggcggtgctaactccgtggct 475

                                                                       
Query: 487 gatgggtacagcacaggtactggattaggtgctgagatcattggtacctttgttttggta 546
            |||| |||||||  ||  |||   | ||||||||||| || || || |||||  | || 
Sbjct: 476 catggctacagcaagggctctgctctcggtgctgagattatcggcacgtttgtgcttgtg 535

                                                                       
Query: 547 tacacagtgttctctgctactgatcccaaaagaagtgccagagattcccatgtgccggtt 606
           ||||| ||||||||||| ||||| || || ||||| ||  | || || || ||||| || 
Sbjct: 536 tacactgtgttctctgcgactgacccgaagagaagcgcgcgtgactctcacgtgccagta 595

                                                                       
Query: 607 ttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatcccagtc 666
            |||| ||  | || ||||| || ||||| |||||||||||| |||||||||| ||  ||
Sbjct: 596 ctggcaccgttgcctattggtttcgctgttttcatggttcacctggccaccatacccatc 655

                                                                 
Query: 667 actggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
           |||||||| |||||||||||||| ||||| || || ||||||||||||||||||
Sbjct: 656 actggtaccggcattaaccctgcaaggagcttcggtgctgctgttatcttcaac 709


>gnl|LJGI|TC80088 homologue to UniRef100_Q946J9 Cluster: Aquaporin protein PIP1;1;
           n=1; Medicago truncatula|Rep: Aquaporin protein PIP1;1 -
           Medicago truncatula (Barrel medic), complete
          Length = 1362

 Score = 95.6 bits (48), Expect = 4e-19
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                       
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
           ||||||||||| || |||||||||||||||   || |||||||||||||| || ||||||
Sbjct: 391 attgcttgggctttcggtggcatgatcttcgctctcgtttactgcaccgccggaatctca 450

                                                       
Query: 307 gggggtcacattaacccagcagtgacatttgggctgttcttggc 350
           || |||||||| ||||| || ||||| ||||||||||| |||||
Sbjct: 451 ggaggtcacataaacccggctgtgacttttgggctgtttttggc 494



 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 94/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 605 ttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatcccag 664
           ||||||| || || || ||||| || ||||||||| |||| || ||||| ||||||||  
Sbjct: 752 ttttggcacctctgcctattgggttcgctgtgttcttggtgcatttggctaccatcccca 811

                                                                   
Query: 665 tcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
           | || || ||||| || ||||||||||||||| | || |||||  |||||||||||
Sbjct: 812 ttacaggaactggtatcaaccctgctaggagtctcggtgctgccattatcttcaac 867



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 732 ctgggatgaccattggatcttctgggtaggaccattcat 770
           ||||||||| || |||||||||||||| |||||||||||
Sbjct: 879 ctgggatgatcactggatcttctgggtgggaccattcat 917


>gnl|LJGI|DN652353 UniRef100_A3F571 Cluster: Aquaporin; n=1; Cucurbita ficifolia|Rep:
           Aquaporin - Cucurbita ficifolia (figleaf gourd), partial
           (6%)
          Length = 255

 Score = 83.8 bits (42), Expect = 2e-15
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 244 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcac 293
           ||||| ||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 206 ggtatagcttgggcctttggtggcatgatcttcgtccttgtttactgcac 255


>gnl|LJGI|TC81950 homologue to UniRef100_Q2TFP3 Cluster: PIP2,2; n=1; Glycine
           max|Rep: PIP2,2 - Glycine max (Soybean), partial (18%)
          Length = 662

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 658 atcccagtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttc 717
           ||||| || ||||| |||||||||||||| || |||||||||||| | ||||||||||||
Sbjct: 9   atccctgttactggcactggcattaacccagcaaggagttttggaccagctgttatcttc 68

              
Query: 718 aac 720
           |||
Sbjct: 69  aac 71


>gnl|LJGI|TC74931 homologue to UniRef100_A0T2N6 Cluster: PIP1 protein; n=1; Gossypium
           hirsutum|Rep: PIP1 protein - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (38%)
          Length = 805

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 94/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 605 ttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatcccag 664
           ||||||| || || || ||||| || ||||||||| |||| || ||||| ||||||||  
Sbjct: 98  ttttggcacctctgcctattgggttcgctgtgttcttggtgcatttggctaccatcccca 157

                                                                   
Query: 665 tcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
           | || || ||||| || ||||||||||||||| | || |||||  |||||||||||
Sbjct: 158 ttacaggaactggtatcaaccctgctaggagtctcggtgctgccattatcttcaac 213



 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 732 ctgggatgaccattggatcttctgggtaggaccattcat 770
           ||||||||| || |||||||||||||| |||||||||||
Sbjct: 225 ctgggatgatcactggatcttctgggtgggaccattcat 263


>gnl|LJGI|BP036983 homologue to UniRef100_Q5DVT6 Cluster: Plasma membrane intrinsic
           protein 2;4; n=1; Mimosa pudica|Rep: Plasma membrane
           intrinsic protein 2;4 - Mimosa pudica (Sensitive plant),
           partial (14%)
          Length = 427

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 745 tggatcttctgggtaggaccattcattggggcagccattgcagcattctaccaccagttc 804
           |||||||||||||| ||||| |||||||| ||  | ||||| ||| |||||||||||| |
Sbjct: 315 tggatcttctgggtgggacctttcattggtgctactattgctgcaatctaccaccagtac 256

                      
Query: 805 atcttgagagc 815
            | ||||||||
Sbjct: 255 gtgttgagagc 245


>gnl|LJGI|AV774659 similar to UniRef100_A0T2N6 Cluster: PIP1 protein; n=1; Gossypium
           hirsutum|Rep: PIP1 protein - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (12%)
          Length = 461

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 732 ctgggatgaccattggatcttctgggtaggaccattcat 770
           ||||||||| || |||||||||||||| |||||||||||
Sbjct: 457 ctgggatgatcactggatcttctgggtgggaccattcat 419


>gnl|LJGI|NP459447 GB|AF145708.1|AAD35016.1 plasma membrane intrinsic protein homolog
           [Lotus japonicus]
          Length = 578

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatc 303
           ||||| |||||||| || ||||| |||||||||   || || |||||||||||||| |||
Sbjct: 175 ggtatcgcttgggctttcggtggtatgatcttcgctctcgtctactgcaccgctggtatc 234

                                  
Query: 304 tcagggggtcacattaacccagc 326
           || || || ||||| ||||||||
Sbjct: 235 tccggtggacacatcaacccagc 257


>gnl|LJGI|TC79198 similar to UniRef100_Q5DVT5 Cluster: Plasma membrane intrinsic
           protein 2;5; n=1; Mimosa pudica|Rep: Plasma membrane
           intrinsic protein 2;5 - Mimosa pudica (Sensitive plant),
           partial (40%)
          Length = 380

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
           ||||| ||| |||| || |||||||||||| |||| || ||||||||||| || ||||| 
Sbjct: 268 attgcctggtccttcggcggcatgatcttcgtcctcgtctactgcaccgccggcatctcc 327

                                 
Query: 307 gggggtcacattaacccagcag 328
           || || ||||| ||||| ||||
Sbjct: 328 ggcggccacatcaaccccgcag 349