Miyakogusa Predicted Gene
- Lj0g3v0065209.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0065209.1 Non Chatacterized Hit- tr|I3T4F8|I3T4F8_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,99.3,0,Aquaporin-like,Aquaporin-like; MINTRINSICP,Major intrinsic
protein; MIP,Major intrinsic protein, con,CUFF.3095.1
(867 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72638 homologue to UniRef100_O65357 Cluster: Aquapori... 1719 0.0
gnl|LJGI|BW598844 homologue to UniRef100_O65357 Cluster: Aquapor... 517 e-146
gnl|LJGI|TC79489 similar to UniRef100_Q5DVT9 Cluster: Plasma mem... 230 1e-59
gnl|LJGI|TC65853 homologue to UniRef100_Q9ATM4 Cluster: Aquapori... 224 7e-58
gnl|LJGI|TC71830 homologue to UniRef100_Q2HV44 Cluster: Major in... 214 7e-55
gnl|LJGI|TC78096 homologue to UniRef100_Q8W1A8 Cluster: Aquapori... 186 2e-46
gnl|LJGI|TC67926 homologue to UniRef100_Q06Z30 Cluster: Aquapori... 153 2e-36
gnl|LJGI|TC80996 similar to UniRef100_Q06Z30 Cluster: Aquaporin ... 143 2e-33
gnl|LJGI|BI420390 homologue to UniRef100_Q5U7L0 Cluster: Plasma ... 119 3e-26
gnl|LJGI|TC67210 homologue to UniRef100_O22339 Cluster: Aquapori... 119 3e-26
gnl|LJGI|TC71350 similar to UniRef100_A3F570 Cluster: Aquaporin;... 107 1e-22
gnl|LJGI|TC67613 homologue to UniRef100_Q5DVT5 Cluster: Plasma m... 107 1e-22
gnl|LJGI|TC80088 homologue to UniRef100_Q946J9 Cluster: Aquapori... 96 4e-19
gnl|LJGI|DN652353 UniRef100_A3F571 Cluster: Aquaporin; n=1; Cucu... 84 2e-15
gnl|LJGI|TC81950 homologue to UniRef100_Q2TFP3 Cluster: PIP2,2; ... 70 3e-11
gnl|LJGI|TC74931 homologue to UniRef100_A0T2N6 Cluster: PIP1 pro... 56 4e-07
gnl|LJGI|BP036983 homologue to UniRef100_Q5DVT6 Cluster: Plasma ... 54 1e-06
gnl|LJGI|AV774659 similar to UniRef100_A0T2N6 Cluster: PIP1 prot... 54 1e-06
gnl|LJGI|NP459447 GB|AF145708.1|AAD35016.1 plasma membrane intri... 54 1e-06
gnl|LJGI|TC79198 similar to UniRef100_Q5DVT5 Cluster: Plasma mem... 52 6e-06
>gnl|LJGI|TC72638 homologue to UniRef100_O65357 Cluster: Aquaporin 2; n=1; Samanea
saman|Rep: Aquaporin 2 - Samanea saman (Rain tree),
complete
Length = 1276
Score = 1719 bits (867), Expect = 0.0
Identities = 867/867 (100%)
Strand = Plus / Plus
Query: 1 atggccaaggacgttgaggttgctgagcgtggctctttctctagcaaggactaccatgac 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 104 atggccaaggacgttgaggttgctgagcgtggctctttctctagcaaggactaccatgac 163
Query: 61 cctcctcctgcacctctcattgatgcagaggagctcacaaagtggtccttctacagggca 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 164 cctcctcctgcacctctcattgatgcagaggagctcacaaagtggtccttctacagggca 223
Query: 121 gtcattgctgagttcattgccactttgcttttcctttacattactgtgctcactgtgatt 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 224 gtcattgctgagttcattgccactttgcttttcctttacattactgtgctcactgtgatt 283
Query: 181 ggctacaaggttcagagtgatgtcaaaaatggtggagatgattgtggaggtgttggcatt 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 ggctacaaggttcagagtgatgtcaaaaatggtggagatgattgtggaggtgttggcatt 343
Query: 241 cttggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctggg 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 344 cttggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctggg 403
Query: 301 atctcagggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtg 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 404 atctcagggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtg 463
Query: 361 tctttgatccgagccatcttgtacatggtggctcagtgcttgggagctatttgtggagtt 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 464 tctttgatccgagccatcttgtacatggtggctcagtgcttgggagctatttgtggagtt 523
Query: 421 gggttggttaaggctttccagaagtctcactacaacaaatatggtggtggagctaactct 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 524 gggttggttaaggctttccagaagtctcactacaacaaatatggtggtggagctaactct 583
Query: 481 cttaatgatgggtacagcacaggtactggattaggtgctgagatcattggtacctttgtt 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cttaatgatgggtacagcacaggtactggattaggtgctgagatcattggtacctttgtt 643
Query: 541 ttggtatacacagtgttctctgctactgatcccaaaagaagtgccagagattcccatgtg 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 644 ttggtatacacagtgttctctgctactgatcccaaaagaagtgccagagattcccatgtg 703
Query: 601 ccggttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatc 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 704 ccggttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatc 763
Query: 661 ccagtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 764 ccagtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 823
Query: 721 caatctaaaccctgggatgaccattggatcttctgggtaggaccattcattggggcagcc 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 824 caatctaaaccctgggatgaccattggatcttctgggtaggaccattcattggggcagcc 883
Query: 781 attgcagcattctaccaccagttcatcttgagagcaggtgcagtgaaggctcttggatca 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 884 attgcagcattctaccaccagttcatcttgagagcaggtgcagtgaaggctcttggatca 943
Query: 841 ttcaggagtaaccccactgtttaagtt 867
|||||||||||||||||||||||||||
Sbjct: 944 ttcaggagtaaccccactgtttaagtt 970
>gnl|LJGI|BW598844 homologue to UniRef100_O65357 Cluster: Aquaporin 2; n=1; Samanea
saman|Rep: Aquaporin 2 - Samanea saman (Rain tree),
partial (31%)
Length = 479
Score = 517 bits (261), Expect = e-146
Identities = 264/265 (99%)
Strand = Plus / Plus
Query: 603 ggttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatccc 662
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 78 ggttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatccc 137
Query: 663 agtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaacca 722
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 138 agtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaacca 197
Query: 723 atctaaaccctgggatgaccattggatcttctgggtaggaccattcattggggcagccat 782
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198 atctaagccctgggatgaccattggatcttctgggtaggaccattcattggggcagccat 257
Query: 783 tgcagcattctaccaccagttcatcttgagagcaggtgcagtgaaggctcttggatcatt 842
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 258 tgcagcattctaccaccagttcatcttgagagcaggtgcagtgaaggctcttggatcatt 317
Query: 843 caggagtaaccccactgtttaagtt 867
|||||||||||||||||||||||||
Sbjct: 318 caggagtaaccccactgtttaagtt 342
>gnl|LJGI|TC79489 similar to UniRef100_Q5DVT9 Cluster: Plasma membrane intrinsic
protein 2;1; n=1; Mimosa pudica|Rep: Plasma membrane
intrinsic protein 2;1 - Mimosa pudica (Sensitive plant),
partial (95%)
Length = 1169
Score = 230 bits (116), Expect = 1e-59
Identities = 224/260 (86%)
Strand = Plus / Plus
Query: 514 ggtgctgagatcattggtacctttgttttggtatacacagtgttctctgctactgatccc 573
||||||||||| ||||| ||||| ||| | || ||||| || |||||||| ||||||||
Sbjct: 555 ggtgctgagattattggcaccttcgttcttgtctacactgttttctctgccactgatcct 614
Query: 574 aaaagaagtgccagagattcccatgtgccggttttggctccacttcccattggatttgct 633
|| |||| || || ||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 615 aagagaaacgctagggattcccatgttcctgttttggctccacttcctattggatttgct 674
Query: 634 gtgttcatggttcacttggccaccatcccagtcactggtactggcattaaccctgctagg 693
|||||||||||||||||||| || ||||| || ||||||||||| |||||||| || |||
Sbjct: 675 gtgttcatggttcacttggctacaatccctgttactggtactggaattaacccagcaagg 734
Query: 694 agttttggagctgctgttatcttcaaccaatctaaaccctgggatgaccattggatcttc 753
||||||||||||||||| |||| |||| || ||| |||||||||||||||||| |||
Sbjct: 735 agttttggagctgctgtcatctacaacgaagacaaaatctgggatgaccattggattttc 794
Query: 754 tgggtaggaccattcattgg 773
||||| |||||||| |||||
Sbjct: 795 tgggttggaccatttattgg 814
Score = 153 bits (77), Expect = 2e-36
Identities = 113/125 (90%)
Strand = Plus / Plus
Query: 244 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatc 303
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 286 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgccggtatc 345
Query: 304 tcagggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtgtct 363
|| || || ||||| ||||| ||||||||||||||||||||| | | || |||||||||
Sbjct: 346 tctggaggacacataaaccctgcagtgacatttgggctgttcataggacgcaaggtgtct 405
Query: 364 ttgat 368
|||||
Sbjct: 406 ttgat 410
Score = 63.9 bits (32), Expect = 2e-09
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 88 gaggagctcacaaagtggtccttctacagggcagtcattgctgagttcattgccac 143
|||||||| |||||||||||||||||||| || |||| ||||||||||| |||||
Sbjct: 142 gaggagctgacaaagtggtccttctacagagctctcatagctgagttcatagccac 197
>gnl|LJGI|TC65853 homologue to UniRef100_Q9ATM4 Cluster: Aquaporin PIP2-7; n=1; Zea
mays|Rep: Aquaporin PIP2-7 - Zea mays (Maize), complete
Length = 1346
Score = 224 bits (113), Expect = 7e-58
Identities = 386/477 (80%)
Strand = Plus / Plus
Query: 244 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatc 303
||||| ||||||||||||||||||||||||||| ||||||||||||||||||| || |||
Sbjct: 418 ggtatagcttgggcctttggtggcatgatcttcgtccttgtttactgcaccgccggtatc 477
Query: 304 tcagggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtgtct 363
||||| || || |||||||| || |||||||||||||| ||| ||| || ||||||||
Sbjct: 478 tcaggagggcatattaaccctgctgtgacatttgggctattcgtgggacgcaaggtgtcc 537
Query: 364 ttgatccgagccatcttgtacatggtggctcagtgcttgggagctatttgtggagttggg 423
|| | | || | ||||||| | || |||||||| || || || ||||| | |||
Sbjct: 538 ctggtaagggcgttactgtacatcattgcacagtgcttaggtgcaatctgtggtgctgga 597
Query: 424 ttggttaaggctttccagaagtctcactacaacaaatatggtggtggagctaactctctt 483
| | ||||| ||||| || || |||||||| |||||| ||||| |||||| | |
Sbjct: 598 cttgctaagggcttccaaaaatcattctacaacagatatggaggtggggctaacacaatc 657
Query: 484 aatgatgggtacagcacaggtactggattaggtgctgagatcattggtacctttgttttg 543
||||| ||||||| ||| || | || |||||||||||||| || ||||||||| |
Sbjct: 658 tcagatggctacagcaaaggcacagctttgggtgctgagatcataggaacctttgttctt 717
Query: 544 gtatacacagtgttctctgctactgatcccaaaagaagtgccagagattcccatgtgccg 603
|| ||||| || ||||||||||||||||| || || | || || ||||||||||| ||
Sbjct: 718 gtctacactgttttctctgctactgatcctaagaggaacgctagggattcccatgttcct 777
Query: 604 gttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatccca 663
|| |||| |||||||| |||||||||||||||||||||||||||||||| || |||||
Sbjct: 778 gtactggcaccacttccaattggatttgctgtgttcatggttcacttggctacaatccct 837
Query: 664 gtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
|| ||||| |||||||||||||| || |||||||||||| | |||||||||||||||
Sbjct: 838 gttactggcactggcattaacccagcaaggagttttggaccagctgttatcttcaac 894
>gnl|LJGI|TC71830 homologue to UniRef100_Q2HV44 Cluster: Major intrinsic protein;
n=1; Medicago truncatula|Rep: Major intrinsic protein -
Medicago truncatula (Barrel medic), partial (97%)
Length = 1178
Score = 214 bits (108), Expect = 7e-55
Identities = 465/584 (79%)
Strand = Plus / Plus
Query: 232 gttggcattcttggtattgcttgggcctttggtggcatgatcttcatccttgtttactgc 291
|||||||| || || || ||||||||||| || |||||||| |||||||| |||||||||
Sbjct: 300 gttggcatcctcggcatcgcttgggccttcggcggcatgattttcatcctcgtttactgc 359
Query: 292 accgctgggatctcagggggtcacattaacccagcagtgacatttgggctgttcttggct 351
||||| || ||||||||||||||||| ||||| || ||||| || || ||||| ||||
Sbjct: 360 accgccggcatctcagggggtcacataaacccggcggtgacgttcggtttgttcctggcg 419
Query: 352 cgtaaggtgtctttgatccgagccatcttgtacatggtggctcagtgcttgggagctatt 411
| ||||| || || || |||| | || ||||||||||||||||| |||||||| ||
Sbjct: 420 aggaaggtttcactggtcagagctttgttctacatggtggctcagtgtttgggagccata 479
Query: 412 tgtggagttgggttggttaaggctttccagaagtctcactacaacaaatatggtggtgga 471
| || ||||||||||| |||||||| ||||| ||||||||| || ||| ||
Sbjct: 480 agcggtgttgggttggtgaaggcttttcagaaaagctactacaacaggtaccatggcggt 539
Query: 472 gctaactctcttaatgatgggtacagcacaggtactggattaggtgctgagatcattggt 531
|| ||| ||| |||||| ||| || || ||||| || || |||||||| || ||
Sbjct: 540 gcaaacatgcttgctgatggctactccaagggaactggtttgggcgctgagattatcggc 599
Query: 532 acctttgttttggtatacacagtgttctctgctactgatcccaaaagaagtgccagagat 591
|||||||| | || ||||| || ||||| || || |||||||| |||| |||||||||
Sbjct: 600 acctttgtccttgtctacaccgtcttctccgccaccgatcccaagagaaacgccagagat 659
Query: 592 tcccatgtgccggttttggctccacttcccattggatttgctgtgttcatggttcacttg 651
|||||||| || |||||||| || ||||| ||||| ||||| ||||||||||||||||||
Sbjct: 660 tcccatgttcctgttttggcacctcttccaattgggtttgcagtgttcatggttcacttg 719
Query: 652 gccaccatcccagtcactggtactggcattaaccctgctaggagttttggagctgctgtt 711
||||||||||| ||||||| || || || ||||||||||| || || |||||||||||
Sbjct: 720 gccaccatccccatcactggaaccggaatcaaccctgctagaagcttcggagctgctgtc 779
Query: 712 atcttcaaccaatctaaaccctgggatgaccattggatcttctgggtaggaccattcatt 771
|| | |||| | || | ||||||||||| |||||||||||||| ||||| ||||||
Sbjct: 780 atatacaacaacgagaaggcatgggatgaccagtggatcttctgggtgggacctttcatt 839
Query: 772 ggggcagccattgcagcattctaccaccagttcatcttgagagc 815
|| || | ||||| ||| |||||||||||| | | ||||||||
Sbjct: 840 ggtgctactattgctgcaatctaccaccagtacgtgttgagagc 883
>gnl|LJGI|TC78096 homologue to UniRef100_Q8W1A8 Cluster: Aquaporin-like protein; n=1;
Petunia x hybrida|Rep: Aquaporin-like protein - Petunia
hybrida (Petunia), partial (30%)
Length = 800
Score = 186 bits (94), Expect = 2e-46
Identities = 151/170 (88%)
Strand = Plus / Plus
Query: 604 gttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatccca 663
||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||
Sbjct: 5 gttttggctccacttcctattggatttgctgtgttcatggttcacttggctacaatccct 64
Query: 664 gtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaaccaa 723
|| ||||||||||| |||||||| || |||||||||||||||||||| |||| |||| ||
Sbjct: 65 gttactggtactggaattaacccagcaaggagttttggagctgctgtcatctacaacgaa 124
Query: 724 tctaaaccctgggatgaccattggatcttctgggtaggaccattcattgg 773
||| |||||||||||||||||| |||||||| |||||||| |||||
Sbjct: 125 gacaaaatctgggatgaccattggattttctgggttggaccatttattgg 174
>gnl|LJGI|TC67926 homologue to UniRef100_Q06Z30 Cluster: Aquaporin 1; n=1; Gossypium
hirsutum|Rep: Aquaporin 1 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (98%)
Length = 1615
Score = 153 bits (77), Expect = 2e-36
Identities = 203/245 (82%)
Strand = Plus / Plus
Query: 529 ggtacctttgttttggtatacacagtgttctctgctactgatcccaaaagaagtgccaga 588
|||||||||||| | || ||||| || |||||||| |||||| |||| |||| |||||||
Sbjct: 695 ggtacctttgttcttgtctacactgtcttctctgccactgatgccaagagaaatgccaga 754
Query: 589 gattcccatgtgccggttttggctccacttcccattggatttgctgtgttcatggttcac 648
|| || ||||| ||| ||||||| || |||||||||||||||||||||||| |||| |||
Sbjct: 755 gactctcatgttccgcttttggccccccttcccattggatttgctgtgttcttggtccac 814
Query: 649 ttggccaccatcccagtcactggtactggcattaaccctgctaggagttttggagctgct 708
||||| ||||| || |||| || |||||||||||||| ||||||||| |||| |||||
Sbjct: 815 ttggctaccattcccatcacaggaactggcattaacccagctaggagtcttggtgctgcc 874
Query: 709 gttatcttcaaccaatctaaaccctgggatgaccattggatcttctgggtaggaccattc 768
|||| | |||| | | | ||||||||||||||||| |||||||| ||||| |||
Sbjct: 875 attatatacaacagagaccatgcttgggatgaccattggattttctgggttggacctttc 934
Query: 769 attgg 773
|||||
Sbjct: 935 attgg 939
Score = 79.8 bits (40), Expect = 3e-14
Identities = 100/120 (83%)
Strand = Plus / Plus
Query: 231 tgttggcattcttggtattgcttgggcctttggtggcatgatcttcatccttgtttactg 290
||||||||| | |||||||||||||| ||||||||||||||||| |||||| |||||
Sbjct: 394 tgttggcatccaaggtattgcttgggcttttggtggcatgatctttgcccttgtctactg 453
Query: 291 caccgctgggatctcagggggtcacattaacccagcagtgacatttgggctgttcttggc 350
||| ||||| || ||||| || |||||||| || || ||||| || || ||||| |||||
Sbjct: 454 cacagctggaatatcaggtgggcacattaatccggctgtgacgttcggtctgtttttggc 513
>gnl|LJGI|TC80996 similar to UniRef100_Q06Z30 Cluster: Aquaporin 1; n=1; Gossypium
hirsutum|Rep: Aquaporin 1 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), complete
Length = 1192
Score = 143 bits (72), Expect = 2e-33
Identities = 171/204 (83%)
Strand = Plus / Plus
Query: 517 gctgagatcattggtacctttgttttggtatacacagtgttctctgctactgatcccaaa 576
|||||||| |||| ||||||||| | || ||||| || |||||||| |||||| ||||
Sbjct: 604 gctgagattgttggcacctttgttcttgtctacaccgttttctctgccactgatgccaag 663
Query: 577 agaagtgccagagattcccatgtgccggttttggctccacttcccattggatttgctgtg 636
|||| || ||||| || ||||| || |||||||||| ||||||||||| |||||||||
Sbjct: 664 agaaacgctagagactctcatgttcctattttggctccccttcccattgggtttgctgtg 723
Query: 637 ttcatggttcacttggccaccatcccagtcactggtactggcattaaccctgctaggagt 696
||| |||| |||||||||||||| || |||| || ||||| |||||||| |||||||||
Sbjct: 724 ttcttggtccacttggccaccattcccatcacaggaactggaattaacccagctaggagt 783
Query: 697 tttggagctgctgttatcttcaac 720
||||||||||| | |||||||||
Sbjct: 784 cttggagctgctttaatcttcaac 807
Score = 79.8 bits (40), Expect = 3e-14
Identities = 91/108 (84%)
Strand = Plus / Plus
Query: 231 tgttggcattcttggtattgcttgggcctttggtggcatgatcttcatccttgtttactg 290
||||||||||| || ||||||||| | ||||||||||||||||| |||||| |||||
Sbjct: 315 tgttggcattcagggcattgcttggtcttttggtggcatgatctttgcccttgtctactg 374
Query: 291 caccgctgggatctcagggggtcacattaacccagcagtgacatttgg 338
||| ||||| || ||||| || ||||| |||||||| ||||| |||||
Sbjct: 375 cactgctggaatttcaggtggacacataaacccagctgtgacctttgg 422
>gnl|LJGI|BI420390 homologue to UniRef100_Q5U7L0 Cluster: Plasma membrane intrinsic
protein; n=1; Glycyrrhiza uralensis|Rep: Plasma membrane
intrinsic protein - Glycyrrhiza uralensis, partial (51%)
Length = 493
Score = 119 bits (60), Expect = 3e-26
Identities = 93/104 (89%)
Strand = Plus / Plus
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
||||||||||| |||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 316 attgcttgggcttttggtggcatgatcttcgcactcgtttactgcactgctggaatctct 375
Query: 307 gggggtcacattaacccagcagtgacatttgggctgttcttggc 350
||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 376 gggggtcacataaacccagcggtgacatttggtctgttcttggc 419
>gnl|LJGI|TC67210 homologue to UniRef100_O22339 Cluster: Aquaporin-like transmembrane
channel protein; n=1; Medicago sativa|Rep:
Aquaporin-like transmembrane channel protein - Medicago
sativa (Alfalfa), complete
Length = 1162
Score = 119 bits (60), Expect = 3e-26
Identities = 93/104 (89%)
Strand = Plus / Plus
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
||||||||||| |||||||||||||||||| || ||||||||||| ||||| |||||
Sbjct: 333 attgcttgggcttttggtggcatgatcttcgcactcgtttactgcactgctggaatctct 392
Query: 307 gggggtcacattaacccagcagtgacatttgggctgttcttggc 350
||||||||||| |||||||| ||||||||||| |||||||||||
Sbjct: 393 gggggtcacataaacccagcggtgacatttggtctgttcttggc 436
Score = 58.0 bits (29), Expect = 1e-07
Identities = 59/69 (85%)
Strand = Plus / Plus
Query: 732 ctgggatgaccattggatcttctgggtaggaccattcattggggcagccattgcagcatt 791
|||||||||||| ||||| |||||||| ||||| |||||||| ||||| |||| ||| |
Sbjct: 822 ctgggatgaccactggattttctgggttggacctttcattggagcagctcttgcggcact 881
Query: 792 ctaccacca 800
||||||||
Sbjct: 882 ttaccacca 890
>gnl|LJGI|TC71350 similar to UniRef100_A3F570 Cluster: Aquaporin; n=1; Cucumis
sativus|Rep: Aquaporin - Cucumis sativus (Cucumber),
partial (97%)
Length = 1168
Score = 107 bits (54), Expect = 1e-22
Identities = 102/118 (86%)
Strand = Plus / Plus
Query: 250 gcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctcaggg 309
|||||| | |||||||| |||||||| ||||| || ||||| ||||| |||||||||
Sbjct: 359 gcttggtcatttggtggaatgatctttgctcttgtctattgcactgctggcatctcaggg 418
Query: 310 ggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtgtctttga 367
|||||||| |||||||||||||||||||||||||||||||| || ||| | |||||||
Sbjct: 419 ggtcacataaacccagcagtgacatttgggctgttcttggcacgcaagctatctttga 476
Score = 71.9 bits (36), Expect = 6e-12
Identities = 51/56 (91%)
Strand = Plus / Plus
Query: 733 tgggatgaccattggatcttctgggtaggaccattcattggggcagccattgcagc 788
||||||||||||||||| || |||||||| ||||||||||||||||| |||||||
Sbjct: 842 tgggatgaccattggatattttgggtagggccattcattggggcagcacttgcagc 897
>gnl|LJGI|TC67613 homologue to UniRef100_Q5DVT5 Cluster: Plasma membrane intrinsic
protein 2;5; n=1; Mimosa pudica|Rep: Plasma membrane
intrinsic protein 2;5 - Mimosa pudica (Sensitive plant),
partial (95%)
Length = 1075
Score = 107 bits (54), Expect = 1e-22
Identities = 369/474 (77%)
Strand = Plus / Plus
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
||||| ||| |||| || |||||||||||| |||| || ||||||||||| || |||||
Sbjct: 236 attgcctggtccttcggcggcatgatcttcgtcctcgtctactgcaccgccggcatctcc 295
Query: 307 gggggtcacattaacccagcagtgacatttgggctgttcttggctcgtaaggtgtctttg 366
|| || ||||| ||||| || || || || || || ||| | ||||| ||||||||| |
Sbjct: 296 ggcggccacatcaaccccgccgtcaccttcggcctcttcctcgctcgcaaggtgtctctc 355
Query: 367 atccgagccatcttgtacatggtggctcagtgcttgggagctatttgtggagttgggttg 426
|| ||||| ||||||||||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 356 attcgagctgtcttgtacatggtagctcagtgcttgggtgctatctgcggtgttgggttg 415
Query: 427 gttaaggctttccagaagtctcactacaacaaatatggtggtggagctaactctcttaat 486
|| ||||| ||| |||| | ||||||| || || || |||||||| | |
Sbjct: 416 gtgaaggcgttcatgaagcacccctacaactccctcggcggcggtgctaactccgtggct 475
Query: 487 gatgggtacagcacaggtactggattaggtgctgagatcattggtacctttgttttggta 546
|||| ||||||| || ||| | ||||||||||| || || || ||||| | ||
Sbjct: 476 catggctacagcaagggctctgctctcggtgctgagattatcggcacgtttgtgcttgtg 535
Query: 547 tacacagtgttctctgctactgatcccaaaagaagtgccagagattcccatgtgccggtt 606
||||| ||||||||||| ||||| || || ||||| || | || || || ||||| ||
Sbjct: 536 tacactgtgttctctgcgactgacccgaagagaagcgcgcgtgactctcacgtgccagta 595
Query: 607 ttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatcccagtc 666
|||| || | || ||||| || ||||| |||||||||||| |||||||||| || ||
Sbjct: 596 ctggcaccgttgcctattggtttcgctgttttcatggttcacctggccaccatacccatc 655
Query: 667 actggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
|||||||| |||||||||||||| ||||| || || ||||||||||||||||||
Sbjct: 656 actggtaccggcattaaccctgcaaggagcttcggtgctgctgttatcttcaac 709
>gnl|LJGI|TC80088 homologue to UniRef100_Q946J9 Cluster: Aquaporin protein PIP1;1;
n=1; Medicago truncatula|Rep: Aquaporin protein PIP1;1 -
Medicago truncatula (Barrel medic), complete
Length = 1362
Score = 95.6 bits (48), Expect = 4e-19
Identities = 90/104 (86%)
Strand = Plus / Plus
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
||||||||||| || ||||||||||||||| || |||||||||||||| || ||||||
Sbjct: 391 attgcttgggctttcggtggcatgatcttcgctctcgtttactgcaccgccggaatctca 450
Query: 307 gggggtcacattaacccagcagtgacatttgggctgttcttggc 350
|| |||||||| ||||| || ||||| ||||||||||| |||||
Sbjct: 451 ggaggtcacataaacccggctgtgacttttgggctgtttttggc 494
Score = 56.0 bits (28), Expect = 4e-07
Identities = 94/116 (81%)
Strand = Plus / Plus
Query: 605 ttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatcccag 664
||||||| || || || ||||| || ||||||||| |||| || ||||| ||||||||
Sbjct: 752 ttttggcacctctgcctattgggttcgctgtgttcttggtgcatttggctaccatcccca 811
Query: 665 tcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
| || || ||||| || ||||||||||||||| | || ||||| |||||||||||
Sbjct: 812 ttacaggaactggtatcaaccctgctaggagtctcggtgctgccattatcttcaac 867
Score = 54.0 bits (27), Expect = 1e-06
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 732 ctgggatgaccattggatcttctgggtaggaccattcat 770
||||||||| || |||||||||||||| |||||||||||
Sbjct: 879 ctgggatgatcactggatcttctgggtgggaccattcat 917
>gnl|LJGI|DN652353 UniRef100_A3F571 Cluster: Aquaporin; n=1; Cucurbita ficifolia|Rep:
Aquaporin - Cucurbita ficifolia (figleaf gourd), partial
(6%)
Length = 255
Score = 83.8 bits (42), Expect = 2e-15
Identities = 48/50 (96%)
Strand = Plus / Plus
Query: 244 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcac 293
||||| ||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 206 ggtatagcttgggcctttggtggcatgatcttcgtccttgtttactgcac 255
>gnl|LJGI|TC81950 homologue to UniRef100_Q2TFP3 Cluster: PIP2,2; n=1; Glycine
max|Rep: PIP2,2 - Glycine max (Soybean), partial (18%)
Length = 662
Score = 69.9 bits (35), Expect = 3e-11
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 658 atcccagtcactggtactggcattaaccctgctaggagttttggagctgctgttatcttc 717
||||| || ||||| |||||||||||||| || |||||||||||| | ||||||||||||
Sbjct: 9 atccctgttactggcactggcattaacccagcaaggagttttggaccagctgttatcttc 68
Query: 718 aac 720
|||
Sbjct: 69 aac 71
>gnl|LJGI|TC74931 homologue to UniRef100_A0T2N6 Cluster: PIP1 protein; n=1; Gossypium
hirsutum|Rep: PIP1 protein - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (38%)
Length = 805
Score = 56.0 bits (28), Expect = 4e-07
Identities = 94/116 (81%)
Strand = Plus / Plus
Query: 605 ttttggctccacttcccattggatttgctgtgttcatggttcacttggccaccatcccag 664
||||||| || || || ||||| || ||||||||| |||| || ||||| ||||||||
Sbjct: 98 ttttggcacctctgcctattgggttcgctgtgttcttggtgcatttggctaccatcccca 157
Query: 665 tcactggtactggcattaaccctgctaggagttttggagctgctgttatcttcaac 720
| || || ||||| || ||||||||||||||| | || ||||| |||||||||||
Sbjct: 158 ttacaggaactggtatcaaccctgctaggagtctcggtgctgccattatcttcaac 213
Score = 54.0 bits (27), Expect = 1e-06
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 732 ctgggatgaccattggatcttctgggtaggaccattcat 770
||||||||| || |||||||||||||| |||||||||||
Sbjct: 225 ctgggatgatcactggatcttctgggtgggaccattcat 263
>gnl|LJGI|BP036983 homologue to UniRef100_Q5DVT6 Cluster: Plasma membrane intrinsic
protein 2;4; n=1; Mimosa pudica|Rep: Plasma membrane
intrinsic protein 2;4 - Mimosa pudica (Sensitive plant),
partial (14%)
Length = 427
Score = 54.0 bits (27), Expect = 1e-06
Identities = 60/71 (84%)
Strand = Plus / Minus
Query: 745 tggatcttctgggtaggaccattcattggggcagccattgcagcattctaccaccagttc 804
|||||||||||||| ||||| |||||||| || | ||||| ||| |||||||||||| |
Sbjct: 315 tggatcttctgggtgggacctttcattggtgctactattgctgcaatctaccaccagtac 256
Query: 805 atcttgagagc 815
| ||||||||
Sbjct: 255 gtgttgagagc 245
>gnl|LJGI|AV774659 similar to UniRef100_A0T2N6 Cluster: PIP1 protein; n=1; Gossypium
hirsutum|Rep: PIP1 protein - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (12%)
Length = 461
Score = 54.0 bits (27), Expect = 1e-06
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 732 ctgggatgaccattggatcttctgggtaggaccattcat 770
||||||||| || |||||||||||||| |||||||||||
Sbjct: 457 ctgggatgatcactggatcttctgggtgggaccattcat 419
>gnl|LJGI|NP459447 GB|AF145708.1|AAD35016.1 plasma membrane intrinsic protein homolog
[Lotus japonicus]
Length = 578
Score = 54.0 bits (27), Expect = 1e-06
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 244 ggtattgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatc 303
||||| |||||||| || ||||| ||||||||| || || |||||||||||||| |||
Sbjct: 175 ggtatcgcttgggctttcggtggtatgatcttcgctctcgtctactgcaccgctggtatc 234
Query: 304 tcagggggtcacattaacccagc 326
|| || || ||||| ||||||||
Sbjct: 235 tccggtggacacatcaacccagc 257
>gnl|LJGI|TC79198 similar to UniRef100_Q5DVT5 Cluster: Plasma membrane intrinsic
protein 2;5; n=1; Mimosa pudica|Rep: Plasma membrane
intrinsic protein 2;5 - Mimosa pudica (Sensitive plant),
partial (40%)
Length = 380
Score = 52.0 bits (26), Expect = 6e-06
Identities = 68/82 (82%)
Strand = Plus / Plus
Query: 247 attgcttgggcctttggtggcatgatcttcatccttgtttactgcaccgctgggatctca 306
||||| ||| |||| || |||||||||||| |||| || ||||||||||| || |||||
Sbjct: 268 attgcctggtccttcggcggcatgatcttcgtcctcgtctactgcaccgccggcatctcc 327
Query: 307 gggggtcacattaacccagcag 328
|| || ||||| ||||| ||||
Sbjct: 328 ggcggccacatcaaccccgcag 349