Miyakogusa Predicted Gene

Lj0g3v0065189.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0065189.1 Non Chatacterized Hit- tr|D8QQ46|D8QQ46_SELML
Putative uncharacterized protein OS=Selaginella
moelle,32.58,1e-18,Acid_phosphat_B,Acid phosphatase (Class B);
seg,NULL,gene.g4698.t1.1
         (513 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64299 weakly similar to UniRef100_A7PIC9 Cluster: Chr...    68   6e-11

>gnl|LJGI|TC64299 weakly similar to UniRef100_A7PIC9 Cluster: Chromosome chr13
           scaffold_17, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr13 scaffold_17, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (9%)
          Length = 750

 Score = 67.9 bits (34), Expect = 6e-11
 Identities = 97/118 (82%)
 Strand = Plus / Plus

                                                                       
Query: 349 atcaaaggaggtcaatatgctagagacttgaacttaactgtgtctatgattgattattac 408
           |||||||||||||||||||||||||||||| | |||||   |||| |||||||  |||||
Sbjct: 28  atcaaaggaggtcaatatgctagagacttggatttaaccaggtctgtgattgaggattac 87

                                                                     
Query: 409 ttcaagagtgttagaccttcagatgatggtttggatgtcgtgttgatggacatagatg 466
           ||  | | ||||||  | || ||||||||| | ||||| || ||||| ||||||||||
Sbjct: 88  tttgataatgttagttcatcggatgatggtcttgatgtggtattgatagacatagatg 145