Miyakogusa Predicted Gene

Lj0g3v0064929.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0064929.2 tr|G9IJ19|G9IJ19_9FABA Cytochrome c biogenesis
protein CcsA OS=Millettia pinnata GN=ccsA PE=3
SV=1,29.09,2.5,seg,NULL,CUFF.3006.2
         (368 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AU089281                                                     452   e-127
gnl|LJGI|TC58828 similar to UniRef100_Q67S65 Cluster: Two-compon...    64   6e-10

>gnl|LJGI|AU089281 
          Length = 376

 Score =  452 bits (228), Expect = e-127
 Identities = 232/234 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcaaagttggatttctttctcggccatgagtttattgttgtccgttggatttctactc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 atgcaaagttggatttctttctcggccatgagtttattgttgtccgttggatttctactc 202

                                                                       
Query: 61  gtctctgctgctatgtgcattgccgcctccgccttggaattcctgcttcgtcgccgctgc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 203 gtctctgctgctatgtgcattgccgcctccgccttggaattcctgcttcgtcgccgctgc 262

                                                                       
Query: 121 ttgctgggtttctttctcgatttatcggccttggtttattgttgttcgttggatttcttt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 263 ttgctgggtttctttctcgatttatcggccttggtttattgttgttcgttggatttcttt 322

                                                                 
Query: 181 gcctctgttttgctgataaacctccttgatttttcaatttattattcaatctat 234
           |||||||||||||||||||||||||||||||||||| |||| ||||||||||||
Sbjct: 323 gcctctgttttgctgataaacctccttgatttttcantttantattcaatctat 376


>gnl|LJGI|TC58828 similar to UniRef100_Q67S65 Cluster: Two-component sensor histidine
           kinase; n=1; Symbiobacterium thermophilum|Rep:
           Two-component sensor histidine kinase - Symbiobacterium
           thermophilum, partial (3%)
          Length = 866

 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 145 tcggccttggtttattgttgttcgttggatttctttgcctctgttttg 192
           ||||||||||||||||||||||| | | ||||| ||||||||||||||
Sbjct: 415 tcggccttggtttattgttgttcctcgaatttccttgcctctgttttg 462