Miyakogusa Predicted Gene
- Lj0g3v0064119.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0064119.2 Non Chatacterized Hit- tr|I1KEG2|I1KEG2_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,59.02,0.000000000006,NB-ARC,NB-ARC; TIR,Toll/interleukin-1
receptor homology (TIR) domain; DISEASE RESISTANCE PROTEIN
(TI,CUFF.2941.2
(2823 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO036231 weakly similar to UniRef100_Q84ZV3 Cluster: R ... 129 1e-28
gnl|LJGI|DC599951 similar to UniRef100_Q6Y4S2 Cluster: Resistanc... 94 6e-18
gnl|LJGI|FS345340 similar to UniRef100_Q8W2C0 Cluster: Functiona... 90 9e-17
gnl|LJGI|TC60890 weakly similar to UniRef100_Q8W2C0 Cluster: Fun... 90 9e-17
gnl|LJGI|TC65260 weakly similar to UniRef100_Q9FVK3 Cluster: Res... 86 1e-15
gnl|LJGI|TC58403 weakly similar to UniRef100_Q9FVK3 Cluster: Res... 86 1e-15
gnl|LJGI|FS357660 similar to UniRef100_Q9FVK4 Cluster: Resistanc... 76 1e-12
gnl|LJGI|DC593180 similar to UniRef100_Q84ZV3 Cluster: R 4 prote... 70 8e-11
gnl|LJGI|TC82142 similar to UniRef100_Q9FVK4 Cluster: Resistance... 70 8e-11
gnl|LJGI|DC599941 weakly similar to UniRef100_A7QH65 Cluster: Ch... 68 3e-10
gnl|LJGI|AV778571 weakly similar to UniRef100_Q84ZV7 Cluster: R ... 62 2e-08
gnl|LJGI|FS355588 weakly similar to UniRef100_Q8W2C0 Cluster: Fu... 60 8e-08
gnl|LJGI|DC593433 weakly similar to UniRef100_Q8W2C0 Cluster: Fu... 60 8e-08
gnl|LJGI|TC76008 weakly similar to UniRef100_Q8W2C0 Cluster: Fun... 56 1e-06
gnl|LJGI|DC595211 weakly similar to UniRef100_Q8RYA9 Cluster: Re... 54 5e-06
>gnl|LJGI|GO036231 weakly similar to UniRef100_Q84ZV3 Cluster: R 4 protein; n=2; Glycine
max|Rep: R 4 protein - Glycine max (Soybean), partial
(21%)
Length = 772
Score = 129 bits (65), Expect = 1e-28
Identities = 116/133 (87%)
Strand = Plus / Plus
Query: 1362 agctaacttgtctggttggcatatcaaacatgggggtggatatgaatatgagtttattga 1421
||||||||||||||| |||||| ||||||| |||| |||||||||||||||||||||||
Sbjct: 492 agctaacttgtctggatggcatttcaaacaaggggatggatatgaatatgagtttattgg 551
Query: 1422 gaggattgttgaagaaatctcaagaaaaattaatcgtgttcctttgcatgttgctgatta 1481
| ||| |||||||| |||||||||| || || ||||| |||| ||||||||||||||
Sbjct: 552 taagatccttgaagaagtctcaagaaatatcaaatgtgttactttacatgttgctgatta 611
Query: 1482 cccaattggattg 1494
|||| ||||||||
Sbjct: 612 cccagttggattg 624
Score = 58.0 bits (29), Expect = 3e-07
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 167 ctttacatgttgccgattacccagttgggttggagtc 203
||||||||||||| |||||||||||||| ||||||||
Sbjct: 593 ctttacatgttgctgattacccagttggattggagtc 629
>gnl|LJGI|DC599951 similar to UniRef100_Q6Y4S2 Cluster: Resistance-like protein
RNEAU-2; n=1; Glycine max|Rep: Resistance-like protein
RNEAU-2 - Glycine max (Soybean), partial (71%)
Length = 395
Score = 93.7 bits (47), Expect = 6e-18
Identities = 137/167 (82%)
Strand = Plus / Plus
Query: 452 gtgtcaatgaaggaatttcagtaataaagcataggctccaccaaaagaagattcttttga 511
|||||| |||||||||||||||||||||||| ||||| | |||||||| |||||||||
Sbjct: 203 gtgtcactgaaggaatttcagtaataaagcaaaggctaaagaaaaagaaggttcttttga 262
Query: 512 ttcttgatgatgtggacaaatttgagcagttggagtcaatgattgggggatctgattggt 571
||||||||||||| ||||| |||| || ||| ||| | |||||| || ||||
Sbjct: 263 ttcttgatgatgttgacaatcttgaacaattgtgttcactagttggggagcctagctggt 322
Query: 572 ttggttttggcagcaaagttatcatcacaactcgagacaaacatttg 618
|||||| ||||| | ||||||||| |||||||| ||||||||||||
Sbjct: 323 ttggttccggcagtacagttatcataacaactcgggacaaacatttg 369
Score = 58.0 bits (29), Expect = 3e-07
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 1801 gttcttttgattcttgatgatgttgacaa 1829
|||||||||||||||||||||||||||||
Sbjct: 253 gttcttttgattcttgatgatgttgacaa 281
>gnl|LJGI|FS345340 similar to UniRef100_Q8W2C0 Cluster: Functional candidate resistance
protein KR1; n=1; Glycine max|Rep: Functional candidate
resistance protein KR1 - Glycine max (Soybean), partial
(4%)
Length = 680
Score = 89.7 bits (45), Expect = 9e-17
Identities = 96/113 (84%)
Strand = Plus / Minus
Query: 2602 aaaacgctaattattagaaatggttgtttttccaaaggtccaaatcatcttccaaatagt 2661
||||| || ||||||| || |||| |||| ||| ||||||| || ||||||||| ||||
Sbjct: 429 aaaacacttattattaaaagtggtcgtttctccgaaggtcccaaatatcttccaagtagt 370
Query: 2662 ttaagagtgctggaatgggagggatatccttcacaatctttaccatctgattt 2714
|| ||||||||||||||| | |||||||||||||| | ||| |||||||||||
Sbjct: 369 ttgagagtgctggaatggcaaggatatccttcacagtattttccatctgattt 317
>gnl|LJGI|TC60890 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max
(Soybean), partial (20%)
Length = 810
Score = 89.7 bits (45), Expect = 9e-17
Identities = 99/117 (84%)
Strand = Plus / Plus
Query: 207 agtgcttgaagtaatatcactcctagatgttggatctgatgatggagtgcacatggtagg 266
|||||| |||||||||||||| |||||||||| ||| ||||||| || |||||||||
Sbjct: 692 agtgctagaagtaatatcacttctagatgttgcatccaatgatggggtttgcatggtagg 751
Query: 267 gatttatggcattggtggaataggaaaaacaacacttgctcgagcagtttataattc 323
|||||| || |||| ||| | || |||||||||||||| ||||||||||| |||||
Sbjct: 752 gatttacggatttggaggagttgggaaaacaacacttgcacgagcagtttacaattc 808
>gnl|LJGI|TC65260 weakly similar to UniRef100_Q9FVK3 Cluster: Resistance protein MG63;
n=1; Glycine max|Rep: Resistance protein MG63 - Glycine
max (Soybean), partial (18%)
Length = 823
Score = 85.7 bits (43), Expect = 1e-15
Identities = 151/187 (80%)
Strand = Plus / Plus
Query: 2551 gaagaagtagtagaatgggatggagaggccttcaagaagatgcaagacctcaaaacgcta 2610
||||||| | |||||||| ||||||||| |||| |||| ||| || | |||| ||| ||
Sbjct: 118 gaagaagaaatagaatggaatggagagggcttcgagaatatgaaaaatctcagaacactt 177
Query: 2611 attattagaaatggttgtttttccaaaggtccaaatcatcttccaaatagtttaagagtg 2670
||| ||||||||| | |||||| |||| ||| | |||||||||||||||| || ||
Sbjct: 178 attgttagaaatgctcatttttctaaagctcccgaatatcttccaaatagtttgagggta 237
Query: 2671 ctggaatgggagggatatccttcacaatctttaccatctgattttcatccggagaaactt 2730
|||||||||| ||||||||||| | | |||||||||| | |||||| || ||||||||
Sbjct: 238 ttggaatgggaaagatatccttcaaagtatttaccatctaactttcatgcgaagaaactt 297
Query: 2731 gcgatat 2737
|| ||||
Sbjct: 298 gccatat 304
>gnl|LJGI|TC58403 weakly similar to UniRef100_Q9FVK3 Cluster: Resistance protein MG63;
n=1; Glycine max|Rep: Resistance protein MG63 - Glycine
max (Soybean), partial (26%)
Length = 790
Score = 85.7 bits (43), Expect = 1e-15
Identities = 151/187 (80%)
Strand = Plus / Plus
Query: 2551 gaagaagtagtagaatgggatggagaggccttcaagaagatgcaagacctcaaaacgcta 2610
||||||| | |||||||| ||||| ||| |||| |||| ||| || | |||| ||| ||
Sbjct: 201 gaagaagaaatagaatggaatggaaagggcttcgagaatatgaaaaatctcagaacactt 260
Query: 2611 attattagaaatggttgtttttccaaaggtccaaatcatcttccaaatagtttaagagtg 2670
||| ||||||||| | |||||| |||| |||| | |||||||||||||||| || ||
Sbjct: 261 attgttagaaatgctcatttttctaaagctccagaatatcttccaaatagtttgagggta 320
Query: 2671 ctggaatgggagggatatccttcacaatctttaccatctgattttcatccggagaaactt 2730
|||||||||| ||||||||||| | | |||||||||| | |||||| || ||||||||
Sbjct: 321 ttggaatgggaaagatatccttcaaagtatttaccatctaactttcatgcgaagaaactt 380
Query: 2731 gcgatat 2737
|| ||||
Sbjct: 381 gccatat 387
>gnl|LJGI|FS357660 similar to UniRef100_Q9FVK4 Cluster: Resistance protein LM17; n=1;
Glycine max|Rep: Resistance protein LM17 - Glycine max
(Soybean), partial (10%)
Length = 701
Score = 75.8 bits (38), Expect = 1e-12
Identities = 140/174 (80%)
Strand = Plus / Minus
Query: 2564 aatgggatggagaggccttcaagaagatgcaagacctcaaaacgctaattattagaaatg 2623
||||| ||||| ||| |||| |||| ||| || | |||| ||| || ||| |||||||||
Sbjct: 701 aatggaatggaaagggcttcgagaatatgaaaaatctcagaacacttattgttagaaatg 642
Query: 2624 gttgtttttccaaaggtccaaatcatcttccaaatagtttaagagtgctggaatgggagg 2683
| |||||| |||| |||| | |||||||||||||||| || || ||||||||||
Sbjct: 641 ctcatttttctaaagctccagaatatcttccaaatagtttgagggtattggaatgggaaa 582
Query: 2684 gatatccttcacaatctttaccatctgattttcatccggagaaacttgcgatat 2737
||||||||||| | | |||||||||| | |||||| || |||||||||| ||||
Sbjct: 581 gatatccttcaaagtatttaccatctaactttcatgcgaagaaacttgccatat 528
>gnl|LJGI|DC593180 similar to UniRef100_Q84ZV3 Cluster: R 4 protein; n=2; Glycine
max|Rep: R 4 protein - Glycine max (Soybean), partial
(17%)
Length = 576
Score = 69.9 bits (35), Expect = 8e-11
Identities = 107/131 (81%)
Strand = Plus / Plus
Query: 232 gatgttggatctgatgatggagtgcacatggtagggatttatggcattggtggaatagga 291
|||||| | |||| |||| |||| |||||||||||||||||||| || || || || ||
Sbjct: 140 gatgtttggtctggtgatagagttcacatggtagggatttatggaataggagggattggt 199
Query: 292 aaaacaacacttgctcgagcagtttataattctattgctgaacaatttggtggtttatgt 351
|||||||||||||||| ||| ||||| || | |||||||| || |||| || |||||
Sbjct: 200 aaaacaacacttgctctagccgtttacaacttgattgctgaccattttgaaggcatatgt 259
Query: 352 tttcttgaaaa 362
||||| |||||
Sbjct: 260 tttctggaaaa 270
Score = 63.9 bits (32), Expect = 5e-09
Identities = 110/136 (80%)
Strand = Plus / Plus
Query: 1526 tggatgttgggtttgatgatggagtcctcatggtaggtatccatggcatttgtgggatag 1585
|||||||| ||| || |||| |||| | ||||||||| || |||| || | ||||| |
Sbjct: 138 tggatgtttggtctggtgatagagttcacatggtagggatttatggaataggagggattg 197
Query: 1586 gtaaaacagcaattgctcgagcagtttataatttgattgccgaccattttgaaagcttgt 1645
|||||||| || |||||| ||| ||||| || |||||||| |||||||||||| || | |
Sbjct: 198 gtaaaacaacacttgctctagccgtttacaacttgattgctgaccattttgaaggcatat 257
Query: 1646 gttttatagaaaatgt 1661
||||| | ||||||||
Sbjct: 258 gttttctggaaaatgt 273
>gnl|LJGI|TC82142 similar to UniRef100_Q9FVK4 Cluster: Resistance protein LM17; n=1;
Glycine max|Rep: Resistance protein LM17 - Glycine max
(Soybean), partial (16%)
Length = 1367
Score = 69.9 bits (35), Expect = 8e-11
Identities = 77/91 (84%)
Strand = Plus / Plus
Query: 2647 catcttccaaatagtttaagagtgctggaatgggagggatatccttcacaatctttacca 2706
|||||||||| ||||| ||||| || |||||| || ||||||||||||| | |||||||
Sbjct: 942 catcttccaagcagtttgagagtactagaatggcagagatatccttcacagtatttacca 1001
Query: 2707 tctgattttcatccggagaaacttgcgatat 2737
|| |||||||||| ||||| ||||| ||||
Sbjct: 1002 cctaattttcatcctgagaatcttgccatat 1032
>gnl|LJGI|DC599941 weakly similar to UniRef100_A7QH65 Cluster: Chromosome chr18
scaffold_96, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr18 scaffold_96, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (11%)
Length = 546
Score = 67.9 bits (34), Expect = 3e-10
Identities = 52/58 (89%)
Strand = Plus / Plus
Query: 1363 gctaacttgtctggttggcatatcaaacatgggggtggatatgaatatgagtttattg 1420
|||||||||||||||||||| ||||||| |||| || ||||||| ||||||||||||
Sbjct: 455 gctaacttgtctggttggcaaatcaaacttgggaatgaatatgaacatgagtttattg 512
Score = 56.0 bits (28), Expect = 1e-06
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 1215 gttggttttacctattttttatgatgtggatccttctgat 1254
||||||||| ||| |||||||||||||| |||||||||||
Sbjct: 283 gttggttttgcctgttttttatgatgtgaatccttctgat 322
>gnl|LJGI|AV778571 weakly similar to UniRef100_Q84ZV7 Cluster: R 12 protein; n=1;
Glycine max|Rep: R 12 protein - Glycine max (Soybean),
partial (12%)
Length = 452
Score = 61.9 bits (31), Expect = 2e-08
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 2789 agaaaaactatcatttgtatattgtgagaatttaa 2823
|||||||||||||||||||||| ||||||||||||
Sbjct: 92 agaaaaactatcatttgtatatagtgagaatttaa 126
>gnl|LJGI|FS355588 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max (Soybean),
partial (13%)
Length = 672
Score = 60.0 bits (30), Expect = 8e-08
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 2628 tttttccaaaggtccaaatcatcttccaaatagtttaagagt 2669
|||||| ||||||||| | |||||||||||||||||||||||
Sbjct: 343 tttttctaaaggtccagagcatcttccaaatagtttaagagt 302
>gnl|LJGI|DC593433 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max (Soybean),
partial (17%)
Length = 585
Score = 60.0 bits (30), Expect = 8e-08
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 2628 tttttccaaaggtccaaatcatcttccaaatagtttaagagt 2669
|||||| ||||||||| | |||||||||||||||||||||||
Sbjct: 69 tttttctaaaggtccagagcatcttccaaatagtttaagagt 110
>gnl|LJGI|TC76008 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max (Soybean),
partial (18%)
Length = 1606
Score = 56.0 bits (28), Expect = 1e-06
Identities = 70/84 (83%)
Strand = Plus / Plus
Query: 2218 gagaagaatatttttcttgacattgcttgtttcttcgaaggatatgaattggcagtggtt 2277
||||| || |||||||||||||||||||||| |||| |||| ||| | ||| | ||||
Sbjct: 523 gagaaaaacatttttcttgacattgcttgttgcttcaaagggtatccactggttgaggtt 582
Query: 2278 gaaaatatactttgtgctcattat 2301
|| |||||||| |||||||||||
Sbjct: 583 caacatatacttcgtgctcattat 606
>gnl|LJGI|DC595211 weakly similar to UniRef100_Q8RYA9 Cluster: Resistance protein
nbs-lrr; n=1; Vigna unguiculata|Rep: Resistance protein
nbs-lrr - Vigna unguiculata (Cowpea), partial (46%)
Length = 524
Score = 54.0 bits (27), Expect = 5e-06
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 474 aataaagcataggctccaccaaaagaagattcttttgattcttgatgatgt 524
|||||| || ||||||| |||||||| ||||||||||||||||||||||
Sbjct: 155 aataaaacacaggctccggcaaaagaaagttcttttgattcttgatgatgt 205