Miyakogusa Predicted Gene

Lj0g3v0063929.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0063929.1 CUFF.2923.1
         (393 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AW719884                                                      60   1e-08

>gnl|LJGI|AW719884 
          Length = 373

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 58/66 (87%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                       
Query: 136 aaacaagatatgcagaacctgttgcagatggggaaacctgcaatccattggagcgaatgg 195
           ||||||||||||||||||||| ||||||||||||||   |||| |||| || ||||| ||
Sbjct: 236 aaacaagatatgcagaacctg-tgcagatggggaaaatcgcaaaccatgggtgcgaacgg 178

                 
Query: 196 gtacct 201
           ||||||
Sbjct: 177 gtacct 172