Miyakogusa Predicted Gene

Lj0g3v0063239.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0063239.1 tr|Q8H1P5|Q8H1P5_SOYBN Urease accessory protein
UreD OS=Glycine max PE=2 SV=1,87.23,1e-16,
,NODE_92446_length_181_cov_12.353591.path2.1
         (141 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77263 similar to UniRef100_Q8H1P5 Cluster: Urease acc...   280   2e-75
gnl|LJGI|TC75016 similar to UniRef100_Q8H1P5 Cluster: Urease acc...   240   2e-63

>gnl|LJGI|TC77263 similar to UniRef100_Q8H1P5 Cluster: Urease accessory protein UreD;
           n=1; Glycine max|Rep: Urease accessory protein UreD -
           Glycine max (Soybean), partial (29%)
          Length = 440

 Score =  280 bits (141), Expect = 2e-75
 Identities = 141/141 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtctgagaaattacagaatccttctgctgccttgagtcaccaaagagacaaggcggat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 38  atgtctgagaaattacagaatccttctgctgccttgagtcaccaaagagacaaggcggat 97

                                                                       
Query: 61  catttcatgacaaaaccaagcttcatggcttcttgcagtgtctttggtcctaagaaaatt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 98  catttcatgacaaaaccaagcttcatggcttcttgcagtgtctttggtcctaagaaaatt 157

                                
Query: 121 ggccttcttgttcgagtggct 141
           |||||||||||||||||||||
Sbjct: 158 ggccttcttgttcgagtggct 178


>gnl|LJGI|TC75016 similar to UniRef100_Q8H1P5 Cluster: Urease accessory protein UreD;
           n=1; Glycine max|Rep: Urease accessory protein UreD -
           Glycine max (Soybean), partial (30%)
          Length = 586

 Score =  240 bits (121), Expect = 2e-63
 Identities = 136/141 (96%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtctgagaaattacagaatccttctgctgccttgagtcaccaaagagacaaggcggat 60
           |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||
Sbjct: 51  atgtctgagaaattacagcatccttctgctgccttgaatcaccaaagagacaaggcggat 110

                                                                       
Query: 61  catttcatgacaaaaccaagcttcatggcttcttgcagtgtctttggtcctaagaaaatt 120
           ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||
Sbjct: 111 catttcatgacaaaaccaaacttcatggcttcttgcagtgtatttggtcctaagaaaatt 170

                                
Query: 121 ggccttcttgttcgagtggct 141
           || ||||||||||||||||||
Sbjct: 171 ggtcttcttgttcgagtggct 191