Miyakogusa Predicted Gene

Lj0g3v0061899.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0061899.1 Non Chatacterized Hit- tr|Q00X15|Q00X15_OSTTA
Putative NPSN12 (ISS) OS=Ostreococcus tauri
GN=Ot13g01,51.14,2e-19,seg,NULL; Helical region found in SNAREs,Target
SNARE coiled-coil domain; no description,NULL; Sec20,CUFF.2773.1
         (396 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80301 similar to UniRef100_Q944A9 Cluster: Novel plan...   222   1e-57

>gnl|LJGI|TC80301 similar to UniRef100_Q944A9 Cluster: Novel plant SNARE 11; n=1;
           Arabidopsis thaliana|Rep: Novel plant SNARE 11 -
           Arabidopsis thaliana (Mouse-ear cress), partial (12%)
          Length = 515

 Score =  222 bits (112), Expect = 1e-57
 Identities = 119/120 (99%), Gaps = 1/120 (0%)
 Strand = Plus / Plus

                                                                       
Query: 278 gagtaattaccatcatc-attgtaaagcttgtgcacccaaacaacaaggacattcgcgac 336
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagtaattaccatcatccattgtaaagcttgtgcacccaaacaacaaggacattcgcgac 60

                                                                       
Query: 337 attccaggattagcccctccagtcatgaaccgaagactgctctggagtcatcacagatga 396
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  attccaggattagcccctccagtcatgaaccgaagactgctctggagtcatcacagatga 120