Miyakogusa Predicted Gene

Lj0g3v0058759.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0058759.1 Non Chatacterized Hit- tr|C6T7T8|C6T7T8_SOYBN
Putative uncharacterized protein OS=Glycine max PE=2 S,96,0.000002,
,CUFF.2584.1
         (106 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58542 homologue to UniRef100_A7P9Y2 Cluster: Chromoso...   135   5e-32

>gnl|LJGI|TC58542 homologue to UniRef100_A7P9Y2 Cluster: Chromosome chr14 scaffold_9,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr14 scaffold_9, whole genome shotgun
            sequence - Vitis vinifera (Grape), complete
          Length = 1592

 Score =  135 bits (68), Expect = 5e-32
 Identities = 74/76 (97%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggtgtacctcggaggtgctgtccttgcaggaataatgaagaatgcaccagagttctgg 60
            |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||
Sbjct: 1096 atggtgtacctcggaggtgctgtccttgcaggcataatgaaggatgcaccagagttctgg 1155

                            
Query: 61   ataaacagggaagatt 76
            ||||||||||||||||
Sbjct: 1156 ataaacagggaagatt 1171