Miyakogusa Predicted Gene
- Lj0g3v0058449.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0058449.1 Non Chatacterized Hit- tr|I1M6Y2|I1M6Y2_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,86.54,0,SUCROSE-PHOSPHATE SYNTHASE,NULL;
GLYCOSYLTRANSFERASE,NULL; UDP-Glycosyltransferase/glycogen
phosphor,CUFF.2571.1
(3210 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS325282 similar to UniRef100_Q9SN30 Cluster: Sucrose-p... 90 1e-16
>gnl|LJGI|FS325282 similar to UniRef100_Q9SN30 Cluster: Sucrose-phosphate
synthase-like protein; n=1; Arabidopsis thaliana|Rep:
Sucrose-phosphate synthase-like protein - Arabidopsis
thaliana (Mouse-ear cress), partial (21%)
Length = 742
Score = 89.7 bits (45), Expect = 1e-16
Identities = 78/89 (87%)
Strand = Plus / Plus
Query: 514 catggattggttcgaggagaaaacatggagcttggtcgagattctgataccggtggacag 573
||||| ||||| ||||||||||| ||||| ||||| ||||||||||||| ||||| |||
Sbjct: 250 catggtttggtacgaggagaaaatatggaacttgggagagattctgatactggtggccag 309
Query: 574 attaaatatgtggtagaacttgctcgtgc 602
| |||||||| |||||||||||||||||
Sbjct: 310 gtcaaatatgtagtagaacttgctcgtgc 338
Score = 77.8 bits (39), Expect = 4e-13
Identities = 84/99 (84%)
Strand = Plus / Plus
Query: 904 tggccatatgtgattcatggacactatgctgatgctggagacagtgctgctcttctttca 963
||||| ||||| || ||||| |||||||||||||||||||| | ||| |||| | | ||
Sbjct: 628 tggccttatgttatccatggtcactatgctgatgctggagagattgcagctcatttatcc 687
Query: 964 ggagctttgaatgtgccaatggtgctcacaggtcattca 1002
|| || ||||||||||| |||||||| ||||||||||||
Sbjct: 688 ggtgcgttgaatgtgcctatggtgctaacaggtcattca 726