Miyakogusa Predicted Gene

Lj0g3v0058359.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0058359.1 tr|C1EBX4|C1EBX4_MICSR Tubulin gamma chain
OS=Micromonas sp. (strain RCC299 / NOUM17) GN=TUBG PE=3
S,64.29,0.00000000000002,no description,Tubulin, C-terminal; Tubulin
C-terminal domain-like,Tubulin/FtsZ, C-terminal;
TUBULIN,NODE_62018_length_299_cov_136.782608.path2.1
         (171 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79627 homologue to UniRef100_Q8GZT0 Cluster: Gamma-tu...   339   3e-93
gnl|LJGI|TC65392 homologue to UniRef100_Q8GZT0 Cluster: Gamma-tu...   313   2e-85

>gnl|LJGI|TC79627 homologue to UniRef100_Q8GZT0 Cluster: Gamma-tubulin; n=1; Lupinus
           albus|Rep: Gamma-tubulin - Lupinus albus (White lupin),
           partial (53%)
          Length = 1126

 Score =  339 bits (171), Expect = 3e-93
 Identities = 171/171 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgctagctagccatactagcattcgtcaccttttcagtaaatgtttgagccagtatgat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 474 atgctagctagccatactagcattcgtcaccttttcagtaaatgtttgagccagtatgat 533

                                                                       
Query: 61  aagttgagaaagaaacaagcctttttagacaactaccggaagttcccaatgtttgctgat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 534 aagttgagaaagaaacaagcctttttagacaactaccggaagttcccaatgtttgctgat 593

                                                              
Query: 121 aatgacctttcagaatttgatgaatcaagggacataattgagagtttggtt 171
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 594 aatgacctttcagaatttgatgaatcaagggacataattgagagtttggtt 644


>gnl|LJGI|TC65392 homologue to UniRef100_Q8GZT0 Cluster: Gamma-tubulin; n=1; Lupinus
           albus|Rep: Gamma-tubulin - Lupinus albus (White lupin),
           partial (34%)
          Length = 1063

 Score =  313 bits (158), Expect = 2e-85
 Identities = 167/170 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgctagctagccatactagcattcgtcaccttttcagtaaatgtttgagccagtatgat 60
           ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 208 atgctggctagccatactagcattcgtcaccttttcggtaaatgtttgagccagtatgat 267

                                                                       
Query: 61  aagttgagaaagaaacaagcctttttagacaactaccggaagttcccaatgtttgctgat 120
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 268 aagttgagaaagaaacaagcctttttagacaactaccggaagttcccaatgtttgccgat 327

                                                             
Query: 121 aatgacctttcagaatttgatgaatcaagggacataattgagagtttggt 170
           ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 aatgacctttcagaatttgatgaatcaagggacataattgagagtttggt 377