Miyakogusa Predicted Gene
- Lj0g3v0057659.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0057659.1 Non Chatacterized Hit- tr|A5K8R1|A5K8R1_PLAVS
Putative uncharacterized protein OS=Plasmodium vivax
(,27.72,4.1,seg,NULL,CUFF.2533.1
(475 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66843 similar to UniRef100_Q6XPS8 Cluster: Drought-in... 761 0.0
gnl|LJGI|TC57669 homologue to UniRef100_Q5FYS3 Cluster: ADP-ribo... 54 8e-07
>gnl|LJGI|TC66843 similar to UniRef100_Q6XPS8 Cluster: Drought-induced protein 1;
n=1; Glycine latifolia|Rep: Drought-induced protein 1 -
Glycine latifolia, partial (68%)
Length = 629
Score = 761 bits (384), Expect = 0.0
Identities = 447/476 (93%), Gaps = 1/476 (0%)
Strand = Plus / Minus
Query: 1 atgattttcaactttcaactttcaactttcaatccaatagagaacnnnnnnn-cccaaac 59
||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 496 atgattttcaactttcaactttcaactttcaatccaatagagaacaaaaaaaacccaaac 437
Query: 60 cggtctaactaggagggcggttcgacggccgtacagtgattctcgccggcaaggggcgtc 119
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 436 cggtctaactaggagggcggttcgacggccgtacagtgattctcgccggcaaggggcgtc 377
Query: 120 cggttccactcccaccgcagctagggcaacccatacggcccgaaccggcgcacgtccggc 179
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 376 cggttccactcccaccgcagctagggcaacccatacggcccgaaccggcgcacgtccggc 317
Query: 180 aaccaacatcgctgtcagaccagcgcgaacagaggcaggagactcgaccggttccgttgc 239
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 316 aaccaacatcgctgtcagaccagcgcgaacagaggcaggagactcgaccggttccgttgc 257
Query: 240 aagttgggcagcgagggaagtttccggccatggggctgttgttatccataaccgacttaa 299
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 256 aagttgggcagcgagggaagtttccggccatggggctgttgttatccataaccgacttaa 197
Query: 300 acataaccgctccggcgaggacgccgagacccgtcgccaattgagtgagcacgatcggac 359
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 196 acataaccgctccggcgaggacgccgagacccgtcgccaattgagtgagcacgatcggac 137
Query: 360 ccatattcttcgagatttgactgcgaacgnnnnnnnnnnnnnnnnnnnnnggtttgaggg 419
||||||||||||||||||||||||||||| ||||||||||
Sbjct: 136 ccatattcttcgagatttgactgcgaacggagaaagagaagagaagagagggtttgaggg 77
Query: 420 tttgcagatttgtgtggtgttgttttggttttgtgagaaattggaagatggataga 475
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 76 tttgcagatttgtgtggtgttgttttggttttgtgagaaattggaagatggataga 21
>gnl|LJGI|TC57669 homologue to UniRef100_Q5FYS3 Cluster: ADP-ribosylation factor;
n=1; Daucus carota|Rep: ADP-ribosylation factor -
Daucus carota (Carrot), partial (97%)
Length = 900
Score = 54.0 bits (27), Expect = 8e-07
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 6 tttcaactttcaactttcaactttcaa 32
|||||||||||||||||||||||||||
Sbjct: 67 tttcaactttcaactttcaactttcaa 41
Score = 54.0 bits (27), Expect = 8e-07
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 6 tttcaactttcaactttcaactttcaa 32
|||||||||||||||||||||||||||
Sbjct: 74 tttcaactttcaactttcaactttcaa 48