Miyakogusa Predicted Gene

Lj0g3v0056099.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0056099.1 Non Chatacterized Hit- tr|I1KRB1|I1KRB1_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,75.5,0,FAD-binding
domain,FAD-binding, type 2; no description,FAD-linked oxidase,
FAD-binding, subdomain 2;,CUFF.2470.1
         (1390 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC57865 similar to UniRef100_A7Q4U0 Cluster: Chromosome...    80   4e-14
gnl|LJGI|TC60652 similar to UniRef100_A7Q4S5 Cluster: Chromosome...    74   3e-12
gnl|LJGI|TC70610 similar to UniRef100_A7Q4U0 Cluster: Chromosome...    70   4e-11
gnl|LJGI|TC79274 similar to UniRef100_Q2HTY5 Cluster: FAD linked...    60   4e-08
gnl|LJGI|TC60320 weakly similar to UniRef100_Q9SVG4 Cluster: Ret...    54   2e-06

>gnl|LJGI|TC57865 similar to UniRef100_A7Q4U0 Cluster: Chromosome chr10 scaffold_50,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr10 scaffold_50, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (41%)
          Length = 812

 Score = 79.8 bits (40), Expect = 4e-14
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 487 catggcttcccagctggggtgtgccccactgttggtgttgggggacacttcagtggtggt 546
           |||||||||||||||||||| || | ||| |||||  |||| |||||| | |||||||||
Sbjct: 562 catggcttcccagctggggtttgtcacacagttgggattggaggacacattagtggtggt 621

                                                                   
Query: 547 ggctatgggaacctgatgagaaggtttggtctctctgtggataatgttctggatgc 602
           || ||||| ||| |||||||||  | ||||||||| || |||||| |||| |||||
Sbjct: 622 ggatatggcaacatgatgagaaaatatggtctctcggttgataatcttcttgatgc 677


>gnl|LJGI|TC60652 similar to UniRef100_A7Q4S5 Cluster: Chromosome chr10 scaffold_50,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr10 scaffold_50, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (36%)
          Length = 765

 Score = 73.8 bits (37), Expect = 3e-12
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 586 gataatgttctggatgctgtaattgttgatgctgatggaagagtccatgacaggaaatca 645
           ||||||||||| ||||||  ||||||||||||  |||| ||| | | ||||||| || | 
Sbjct: 636 gataatgttctagatgctcaaattgttgatgccaatggcagaattcttgacagggaagcc 695

                                                                
Query: 646 atgggggaagatcttttctgggctattggaggaggtgggggtgctagctttgg 698
           ||||||||||| ||||| ||||||||  |||||||||| ||||  ||||||||
Sbjct: 696 atgggggaagagcttttttgggctatcagaggaggtggtggtggaagctttgg 748


>gnl|LJGI|TC70610 similar to UniRef100_A7Q4U0 Cluster: Chromosome chr10 scaffold_50,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr10 scaffold_50, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (31%)
          Length = 723

 Score = 69.9 bits (35), Expect = 4e-11
 Identities = 87/103 (84%), Gaps = 1/103 (0%)
 Strand = Plus / Plus

                                                                       
Query: 466 attgcagagaagagcaggatccatggcttcccagctggggtgtgccccactgttggtgtt 525
           ||||| |||||||| || |  |||||||||||||| |||||||| |||||||| || |||
Sbjct: 574 attgctgagaagagtagaaaacatggcttcccagcaggggtgtgtcccactgtaggggtt 633

                                                      
Query: 526 gggggacacttcagtggtggtggctatgggaacctgatgagaa 568
            || ||||  | ||||||||||||||||| ||| |||||||||
Sbjct: 634 -ggagacatgttagtggtggtggctatggcaacatgatgagaa 675


>gnl|LJGI|TC79274 similar to UniRef100_Q2HTY5 Cluster: FAD linked oxidase,
           N-terminal; n=1; Medicago truncatula|Rep: FAD linked
           oxidase, N-terminal - Medicago truncatula (Barrel
           medic), partial (71%)
          Length = 1252

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 646 atgggggaagatcttttctgggctattggaggaggtgggggtgctagctttggggtcata 705
           ||||| |||||||| || |||||||||  ||||||||| || || || ||||||||||| 
Sbjct: 323 atgggagaagatctattttgggctattaaaggaggtggtggggccagttttggggtcatt 382

                                         
Query: 706 gtttcctggaaaatcaagttggttcctgtg 735
            | || ||||| ||||| ||||||||||||
Sbjct: 383 ctgtcatggaagatcaaattggttcctgtg 412


>gnl|LJGI|TC60320 weakly similar to UniRef100_Q9SVG4 Cluster: Reticuline oxidase-like
           protein precursor; n=1; Arabidopsis thaliana|Rep:
           Reticuline oxidase-like protein precursor - Arabidopsis
           thaliana (Mouse-ear cress), partial (50%)
          Length = 1070

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 640 aaatcaatgggggaagatcttttctgggctattggaggaggtgggggtgctagctttgg 698
           ||||||||||| |||||| | |||||||||||| |||| ||||| || | |||||||||
Sbjct: 696 aaatcaatgggtgaagatttgttctgggctattagaggtggtggtggaggtagctttgg 754