Miyakogusa Predicted Gene
- Lj0g3v0055219.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0055219.1 tr|K1PLH3|K1PLH3_CRAGI Retinoblastoma-associated
protein OS=Crassostrea gigas PE=4
SV=1,42.22,1.6,seg,NULL,gene.g3856.t1.1
(606 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC70170 weakly similar to UniRef100_A6H573 Cluster: Cel... 151 6e-36
gnl|LJGI|TC73030 141 6e-33
gnl|LJGI|BP044806 weakly similar to UniRef100_Q010M7 Cluster: Pr... 60 2e-08
gnl|LJGI|TC66929 similar to UniRef100_A8HYV0 Cluster: Predicted ... 60 2e-08
gnl|LJGI|AV775660 58 7e-08
>gnl|LJGI|TC70170 weakly similar to UniRef100_A6H573 Cluster: Cell-wall anchoring
protein precursor; n=1; Ruminococcus flavefaciens|Rep:
Cell-wall anchoring protein precursor - Ruminococcus
flavefaciens, partial (8%)
Length = 573
Score = 151 bits (76), Expect = 6e-36
Identities = 79/80 (98%)
Strand = Plus / Minus
Query: 1 atgttctctctaagtcggtttcacggtcttaacctatggaacgagtcttcaagtgtgatt 60
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 atgttctctttaagtcggtttcacggtcttaacctatggaacgagtcttcaagtgtgatt 363
Query: 61 tccttgattagtatcatcag 80
||||||||||||||||||||
Sbjct: 362 tccttgattagtatcatcag 343
>gnl|LJGI|TC73030
Length = 609
Score = 141 bits (71), Expect = 6e-33
Identities = 92/99 (92%)
Strand = Plus / Plus
Query: 381 ttccgaaagcacgatgggtcttctctcgaacttggagagagcagatcgatggagatctga 440
|||||||||||| ||||||||||||||||||||||| ||||||||| |||| ||||||||
Sbjct: 4 ttccgaaagcacaatgggtcttctctcgaacttggacagagcagattgatgaagatctga 63
Query: 441 gttggggatcttctccgagcccacgcccttgctccgccg 479
| |||||| || |||||||||||||||||||||||||||
Sbjct: 64 gctggggaactcctccgagcccacgcccttgctccgccg 102
>gnl|LJGI|BP044806 weakly similar to UniRef100_Q010M7 Cluster: Predicted membrane
protein; n=1; Ostreococcus tauri|Rep: Predicted membrane
protein -, partial (1%)
Length = 538
Score = 60.0 bits (30), Expect = 2e-08
Identities = 30/30 (100%)
Strand = Plus / Minus
Query: 538 aagaagaagatgaaggaggaggagatgaag 567
||||||||||||||||||||||||||||||
Sbjct: 224 aagaagaagatgaaggaggaggagatgaag 195
>gnl|LJGI|TC66929 similar to UniRef100_A8HYV0 Cluster: Predicted protein; n=1;
Chlamydomonas reinhardtii|Rep: Predicted protein -
Chlamydomonas reinhardtii, partial (5%)
Length = 591
Score = 60.0 bits (30), Expect = 2e-08
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 290 gccaccaccacttctgggtctcaatctcctgggtttcttctt 331
||||||||||||| ||||||||| ||| ||||||||||||||
Sbjct: 424 gccaccaccacttatgggtctcactcttctgggtttcttctt 465
>gnl|LJGI|AV775660
Length = 487
Score = 58.0 bits (29), Expect = 7e-08
Identities = 35/37 (94%)
Strand = Plus / Minus
Query: 427 cgatggagatctgagttggggatcttctccgagccca 463
|||||||||||||| |||||||||| |||||||||||
Sbjct: 487 cgatggagatctgacttggggatctcctccgagccca 451