Miyakogusa Predicted Gene
- Lj0g3v0047529.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0047529.1 CUFF.2199.1
(456 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BI417964 64 8e-10
gnl|LJGI|TC81314 similar to UniRef100_Q0JQ75 Cluster: Os01g01781... 64 8e-10
gnl|LJGI|TC79898 homologue to UniRef100_A8YAX2 Cluster: Genome s... 64 8e-10
gnl|LJGI|TC76768 64 8e-10
gnl|LJGI|TC73793 weakly similar to UniRef100_Q4RQ54 Cluster: Chr... 64 8e-10
gnl|LJGI|TC72630 weakly similar to UniRef100_A7DTG3 Cluster: SER... 64 8e-10
gnl|LJGI|TC68986 56 2e-07
>gnl|LJGI|BI417964
Length = 433
Score = 63.9 bits (32), Expect = 8e-10
Identities = 32/32 (100%)
Strand = Plus / Minus
Query: 1 atgagtcatcgccattatcttcacgaccatct 32
||||||||||||||||||||||||||||||||
Sbjct: 247 atgagtcatcgccattatcttcacgaccatct 216
>gnl|LJGI|TC81314 similar to UniRef100_Q0JQ75 Cluster: Os01g0178100 protein; n=1;
Oryza sativa Japonica Group|Rep: Os01g0178100 protein -
Oryza sativa subsp. japonica (Rice), partial (4%)
Length = 360
Score = 63.9 bits (32), Expect = 8e-10
Identities = 32/32 (100%)
Strand = Plus / Minus
Query: 1 atgagtcatcgccattatcttcacgaccatct 32
||||||||||||||||||||||||||||||||
Sbjct: 100 atgagtcatcgccattatcttcacgaccatct 69
>gnl|LJGI|TC79898 homologue to UniRef100_A8YAX2 Cluster: Genome sequencing data,
contig C262; n=1; Microcystis aeruginosa PCC 7806|Rep:
Genome sequencing data, contig C262 - Microcystis
aeruginosa PCC 7806, partial (10%)
Length = 547
Score = 63.9 bits (32), Expect = 8e-10
Identities = 32/32 (100%)
Strand = Plus / Minus
Query: 1 atgagtcatcgccattatcttcacgaccatct 32
||||||||||||||||||||||||||||||||
Sbjct: 293 atgagtcatcgccattatcttcacgaccatct 262
>gnl|LJGI|TC76768
Length = 560
Score = 63.9 bits (32), Expect = 8e-10
Identities = 32/32 (100%)
Strand = Plus / Minus
Query: 1 atgagtcatcgccattatcttcacgaccatct 32
||||||||||||||||||||||||||||||||
Sbjct: 292 atgagtcatcgccattatcttcacgaccatct 261
>gnl|LJGI|TC73793 weakly similar to UniRef100_Q4RQ54 Cluster: Chromosome 17
SCAF15006, whole genome shotgun sequence; n=1; Tetraodon
nigroviridis|Rep: Chromosome 17 SCAF15006, whole genome
shotgun sequence - Tetraodon nigroviridis (Green
puffer), partial (3%)
Length = 499
Score = 63.9 bits (32), Expect = 8e-10
Identities = 32/32 (100%)
Strand = Plus / Minus
Query: 1 atgagtcatcgccattatcttcacgaccatct 32
||||||||||||||||||||||||||||||||
Sbjct: 277 atgagtcatcgccattatcttcacgaccatct 246
>gnl|LJGI|TC72630 weakly similar to UniRef100_A7DTG3 Cluster: SERTA domain-containing
protein 4; n=1; Mus musculus|Rep: SERTA
domain-containing protein 4 - Mus musculus (Mouse),
partial (10%)
Length = 484
Score = 63.9 bits (32), Expect = 8e-10
Identities = 32/32 (100%)
Strand = Plus / Minus
Query: 1 atgagtcatcgccattatcttcacgaccatct 32
||||||||||||||||||||||||||||||||
Sbjct: 248 atgagtcatcgccattatcttcacgaccatct 217
>gnl|LJGI|TC68986
Length = 533
Score = 56.0 bits (28), Expect = 2e-07
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 5 gtcatcgccattatcttcacgaccatct 32
||||||||||||||||||||||||||||
Sbjct: 278 gtcatcgccattatcttcacgaccatct 251