Miyakogusa Predicted Gene

Lj0g3v0046959.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0046959.1 tr|E9PZF0|E9PZF0_MOUSE Nucleoside diphosphate
kinase OS=Mus musculus GN=Gm20390 PE=3 SV=1,51.22,0.0001,no
description,Nucleoside diphosphate kinase; NDK,Nucleoside diphosphate
kinase; NDP_KINASES,Nucleos,
NODE_57829_length_937_cov_127.798294.path1.1
         (240 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC57381 similar to UniRef100_Q8LAH8 Cluster: Nucleoside...   476   e-134
gnl|LJGI|TC66373 similar to UniRef100_Q9SP13 Cluster: Nucleoside...   238   1e-62
gnl|LJGI|GO020381 homologue to UniRef100_A5BVN4 Cluster: Nucleos...   234   2e-61

>gnl|LJGI|TC57381 similar to UniRef100_Q8LAH8 Cluster: Nucleoside diphosphate kinase
           IV, chloroplast/mitochondrial precursor; n=2;
           Arabidopsis thaliana|Rep: Nucleoside diphosphate kinase
           IV, chloroplast/mitochondrial precursor - Arabidopsis
           thaliana (Mouse-ear cress), partial (95%)
          Length = 976

 Score =  476 bits (240), Expect = e-134
 Identities = 240/240 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggtctgggaaggacagggagcaatatcatatggccgaaagctaattggggccacagat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 548 atggtctgggaaggacagggagcaatatcatatggccgaaagctaattggggccacagat 607

                                                                       
Query: 61  ccccagaagtcagaacctggaactattagaggcgatctggctgtcatcgttggaagaaat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 608 ccccagaagtcagaacctggaactattagaggcgatctggctgtcatcgttggaagaaat 667

                                                                       
Query: 121 atcatccatgggagtgatggtccagagactgccaaggatgaagtcaacttgtggtttaag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 668 atcatccatgggagtgatggtccagagactgccaaggatgaagtcaacttgtggtttaag 727

                                                                       
Query: 181 ccagaagagttggttaatttcactagcaatgcagagaagtgggtctatggttccaactga 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 728 ccagaagagttggttaatttcactagcaatgcagagaagtgggtctatggttccaactga 787


>gnl|LJGI|TC66373 similar to UniRef100_Q9SP13 Cluster: Nucleoside diphosphate kinase;
           n=1; Pisum sativum|Rep: Nucleoside diphosphate kinase -
           Pisum sativum (Garden pea), partial (96%)
          Length = 1044

 Score =  238 bits (120), Expect = 1e-62
 Identities = 210/240 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggtctgggaaggacagggagcaatatcatatggccgaaagctaattggggccacagat 60
           ||||| ||||||||| ||||||  ||  | ||||||||||| |||||||| || ||||||
Sbjct: 570 atggtgtgggaaggagagggagttatcacctatggccgaaaactaattggagcgacagat 629

                                                                       
Query: 61  ccccagaagtcagaacctggaactattagaggcgatctggctgtcatcgttggaagaaat 120
           || ||||| ||| |||||||||| ||||| || ||||| |||||  | ||||||||||||
Sbjct: 630 cctcagaaatcacaacctggaaccattaggggtgatctagctgttgttgttggaagaaat 689

                                                                       
Query: 121 atcatccatgggagtgatggtccagagactgccaaggatgaagtcaacttgtggtttaag 180
           |||||||||||||| |||||||| |||||||||||||||||  | || ||||||||||||
Sbjct: 690 atcatccatgggagcgatggtccggagactgccaaggatgagattaagttgtggtttaag 749

                                                                       
Query: 181 ccagaagagttggttaatttcactagcaatgcagagaagtgggtctatggttccaactga 240
           ||||| |||||||||||||||||||||||||||||||||||||| ||||||  |||||||
Sbjct: 750 ccagaggagttggttaatttcactagcaatgcagagaagtgggtttatggtgtcaactga 809


>gnl|LJGI|GO020381 homologue to UniRef100_A5BVN4 Cluster: Nucleoside diphosphate
           kinase; n=1; Vitis vinifera|Rep: Nucleoside diphosphate
           kinase - Vitis vinifera (Grape), partial (31%)
          Length = 477

 Score =  234 bits (118), Expect = 2e-61
 Identities = 187/210 (89%)
 Strand = Plus / Plus

                                                                       
Query: 31  tatggccgaaagctaattggggccacagatccccagaagtcagaacctggaactattaga 90
           ||||||||||| |||||||| || |||||||| ||||| ||| |||||||||| ||||| 
Sbjct: 73  tatggccgaaaactaattggagcgacagatcctcagaaatcacaacctggaaccattagg 132

                                                                       
Query: 91  ggcgatctggctgtcatcgttggaagaaatatcatccatgggagtgatggtccagagact 150
           || ||||| |||||  | |||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 133 ggtgatctagctgttgttgttggaagaaatatcatccatgggagcgatggtccggagact 192

                                                                       
Query: 151 gccaaggatgaagtcaacttgtggtttaagccagaagagttggttaatttcactagcaat 210
           |||||||||||  | || ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 193 gccaaggatgagattaagttgtggtttaagccagaggagttggttaatttcactagcaat 252

                                         
Query: 211 gcagagaagtgggtctatggttccaactga 240
           |||||||||||||| ||||||  |||||||
Sbjct: 253 gcagagaagtgggtttatggtgtcaactga 282