Miyakogusa Predicted Gene

Lj0g3v0046579.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0046579.1 Non Chatacterized Hit- tr|I1MWQ1|I1MWQ1_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,36.89,4e-17,UBN2_3,NULL,CUFF.2157.1
         (591 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71336 weakly similar to UniRef100_A4UCN1 Cluster: Pre...   133   1e-30

>gnl|LJGI|TC71336 weakly similar to UniRef100_A4UCN1 Cluster: Predicted protein; n=1;
           Magnaporthe grisea|Rep: Predicted protein - Magnaporthe
           grisea (Rice blast fungus) (Pyricularia grisea), partial
           (6%)
          Length = 745

 Score =  133 bits (67), Expect = 1e-30
 Identities = 73/75 (97%)
 Strand = Plus / Plus

                                                                       
Query: 2   tgagttggcgtgatgctgttgacatttggtttgttggtcagggattatctgaccatcttt 61
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 671 tgagttggcgtgatgctgttgacatttggtttgttggtcagggattatctgaccatcttt 730

                          
Query: 62  ctttcaaggtttctg 76
           ||  |||||||||||
Sbjct: 731 ctaccaaggtttctg 745