Miyakogusa Predicted Gene

Lj0g3v0045019.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0045019.1 tr|Q9AIU6|Q9AIU6_NEIME IgA1 protease OS=Neisseria
meningitidis PE=4 SV=1,33.06,0.006,coiled-coil,NULL;
seg,NULL,CUFF.2183.1
         (1120 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71180 weakly similar to UniRef100_A4RUA2 Cluster: Pre...   170   1e-41

>gnl|LJGI|TC71180 weakly similar to UniRef100_A4RUA2 Cluster: Predicted protein; n=1;
            Ostreococcus lucimarinus CCE9901|Rep: Predicted protein -
            Ostreococcus lucimarinus (strain CCE9901), partial (17%)
          Length = 1653

 Score =  170 bits (86), Expect = 1e-41
 Identities = 175/205 (85%), Gaps = 6/205 (2%)
 Strand = Plus / Plus

                                                                        
Query: 810  gccaccggcgaagcctccggattcggcggaggacggcggcgaaagaaaggaagatgacgg 869
            ||||||||||||||| || || ||  || |||||||| | | |||||||  |||||| ||
Sbjct: 161  gccaccggcgaagccaccagactcaacgaaggacggcagaggaagaaagagagatgaagg 220

                                                                        
Query: 870  cgtgaaaggctcgatactcgctgttacagtgaaggggaagaagccacaaaagagtgggtg 929
            ||||||||| |||||||| |||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 221  cgtgaaaggttcgatactggctgttacagtgaaggggaagaggccaccaaagagtgggtg 280

                                                                        
Query: 930  ccttctgaa------cccctcttccattcgagtgggtcaagcccaagctgctcaaagagg 983
            ||| |||||      ||||||| ||||||||||||| |||||||||| || ||||||| |
Sbjct: 281  cctgctgaacccctccccctctcccattcgagtgggccaagcccaagttgttcaaagaag 340

                                     
Query: 984  gaattgggccttgctggagttgggt 1008
            || |||||||||||||| |||||||
Sbjct: 341  gagttgggccttgctggtgttgggt 365



 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                       
Query: 79  gaagcggcagcggcgtacgagagacacgtcgcagaatacgagcggtacatggcggcatat 138
           ||||||||||||||||| ||| | ||||| || |||||||||| |||||||||||| || 
Sbjct: 900 gaagcggcagcggcgtatgagcgccacgtggccgaatacgagcagtacatggcggcgtac 959

                               
Query: 139 gagcggtacgaggcgaaagc 158
           ||||||||||| || |||||
Sbjct: 960 gagcggtacgaagccaaagc 979