Miyakogusa Predicted Gene

Lj0g3v0044549.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0044549.1 CUFF.2081.1
         (549 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS323379 similar to UniRef100_A2Q6G3 Cluster: TIR; AAA ...   194   4e-49
gnl|LJGI|TC70945 similar to UniRef100_A2Q6G7 Cluster: TIR; Disea...   176   9e-44
gnl|LJGI|DC593151 similar to UniRef100_Q0PJH9 Cluster: MYB trans...   155   3e-37
gnl|LJGI|TC61438 weakly similar to UniRef100_A2Q6G5 Cluster: TIR...    80   2e-14
gnl|LJGI|FS326053 weakly similar to UniRef100_A2Q6G5 Cluster: TI...    58   6e-08

>gnl|LJGI|FS323379 similar to UniRef100_A2Q6G3 Cluster: TIR; AAA ATPase; n=1; Medicago
           truncatula|Rep: TIR; AAA ATPase - Medicago truncatula
           (Barrel medic), partial (10%)
          Length = 728

 Score =  194 bits (98), Expect = 4e-49
 Identities = 185/214 (86%)
 Strand = Plus / Plus

                                                                       
Query: 336 aaagatctacgatgtgttcttgaatttcagaggggaagacagtcgtgcaaaattcatttt 395
           ||||||||| |||||||| |||| ||| ||||| ||||||||||| ||||| ||||||| 
Sbjct: 227 aaagatctatgatgtgtttttgagttttagaggagaagacagtcgcgcaaagttcatttc 286

                                                                       
Query: 396 acatctctatgcctctcttcaaaatgccgggattaatgttttcagagatgatgatgagat 455
           ||||||||||||| | || |||||||| ||| || |||||||||||||  ||||||||||
Sbjct: 287 acatctctatgccgccctccaaaatgctggggtttatgttttcagagacaatgatgagat 346

                                                                       
Query: 456 tcaacggggagatacgatctccgtctcactactgcgagctatcagaaattctagaatttc 515
           | |||||||||||  ||||||   ||||||| ||||||||||||| || |||||||||| 
Sbjct: 347 tgaacggggagatgggatctcatcctcactattgcgagctatcagcaaatctagaatttg 406

                                             
Query: 516 tatcgtggttttttcaaaatattatgctaattca 549
           ||| |||||||| |||||| ||||||||||||||
Sbjct: 407 tatagtggttttgtcaaaacattatgctaattca 440


>gnl|LJGI|TC70945 similar to UniRef100_A2Q6G7 Cluster: TIR; Disease resistance
           protein; n=1; Medicago truncatula|Rep: TIR; Disease
           resistance protein - Medicago truncatula (Barrel medic),
           partial (30%)
          Length = 800

 Score =  176 bits (89), Expect = 9e-44
 Identities = 185/216 (85%), Gaps = 2/216 (0%)
 Strand = Plus / Plus

                                                                       
Query: 336 aaagatctacgatgtgttcttgaatttcagaggggaagacagtcgtgcaaaattcatttt 395
           |||||| ||||||||||| |||| ||| ||||| ||||||||||| ||||| ||||||| 
Sbjct: 168 aaagatgtacgatgtgtttttgagttttagaggagaagacagtcgcgcaaagttcatttc 227

                                                                       
Query: 396 acatctctatgcctctcttcaaaatgccgggattaatgttttcagagatgatgatgagat 455
           |||||||||||||||||| |||||||| || ||| |||||||||||||  ||||||||||
Sbjct: 228 acatctctatgcctctctccaaaatgctggcatttatgttttcagagacaatgatgagat 287

                                                                       
Query: 456 tcaacggggagatacgatctccgtctcactactgcgagctatcagaaattctagaatttc 515
           | |||||||||||  | ||||   ||||||| |||||||||||||  | |||| ||||| 
Sbjct: 288 tgaacggggagattgggtctcatactcactaatgcgagctatcagtcaatctaaaatttg 347

                                               
Query: 516 tatcgtggttttttcaaaatattat--gctaattca 549
           |||||||||||| |||||| |||||  |||||||||
Sbjct: 348 tatcgtggttttgtcaaaacattatatgctaattca 383


>gnl|LJGI|DC593151 similar to UniRef100_Q0PJH9 Cluster: MYB transcription factor
           MYB173; n=1; Glycine max|Rep: MYB transcription factor
           MYB173 - Glycine max (Soybean), partial (39%)
          Length = 572

 Score =  155 bits (78), Expect = 3e-37
 Identities = 120/134 (89%)
 Strand = Plus / Plus

                                                                       
Query: 336 aaagatctacgatgtgttcttgaatttcagaggggaagacagtcgtgcaaaattcatttt 395
           |||||||||||||||||| |||| |||  |||| ||||||||||| ||||| ||||||| 
Sbjct: 434 aaagatctacgatgtgtttttgagttttcgaggagaagacagtcgcgcaaagttcatttc 493

                                                                       
Query: 396 acatctctatgcctctcttcaaaatgccgggattaatgttttcagagatgatgatgagat 455
           |||||| ||| |||||||||||||||| |||||| ||||||||||||| |||||||||||
Sbjct: 494 acatctatatacctctcttcaaaatgctgggatttatgttttcagagacgatgatgagat 553

                         
Query: 456 tcaacggggagata 469
           | ||||||||||||
Sbjct: 554 taaacggggagata 567


>gnl|LJGI|TC61438 weakly similar to UniRef100_A2Q6G5 Cluster: TIR; n=1; Medicago
           truncatula|Rep: TIR - Medicago truncatula (Barrel
           medic), partial (33%)
          Length = 751

 Score = 79.8 bits (40), Expect = 2e-14
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 344 acgatgtgttcttgaatttcagaggggaagacagtcgtgcaaaattcattttacatctct 403
           ||||||||||||||| ||||||||||||||||| ||||||    |||| || ||||||||
Sbjct: 394 acgatgtgttcttgagtttcagaggggaagacactcgtgcttccttcacttcacatctct 453

                           
Query: 404 atgcctctcttcaaaa 419
           ||||| ||||||||||
Sbjct: 454 atgccgctcttcaaaa 469


>gnl|LJGI|FS326053 weakly similar to UniRef100_A2Q6G5 Cluster: TIR; n=1; Medicago
           truncatula|Rep: TIR - Medicago truncatula (Barrel
           medic), partial (31%)
          Length = 695

 Score = 58.0 bits (29), Expect = 6e-08
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 349 gtgttcttgaatttcagaggggaagacagtcgtgcaaaattcattttacatctctatgcc 408
           |||||||||| |||||||||||| || | ||||||    |||| || |||||||||||||
Sbjct: 333 gtgttcttgagtttcagaggggaggatactcgtgcttccttcacttcacatctctatgcc 392

                            
Query: 409 tctcttcaaaatgccgg 425
            |||||||||| |||||
Sbjct: 393 gctcttcaaaacgccgg 409